Kit capable of performing semiquantitative detection on micro ribonucleic acid 100 (microRNA100) directly

A microRNA, semi-quantitative technology, applied in the fields of medicine and molecular biology, can solve the problems of high price, low sensitivity, long time consumption, etc., and achieve the effect of short detection time, high specificity and low detection limit

Inactive Publication Date: 2017-06-13
中国医科大学
View PDF2 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Traditional microRNA detection methods include Northern Blotting and the combined application of reverse transcription and real-time quantitative PCR (realtime PCR). These methods are relatively mature and widely used, but they are cumbersome, expensive, and time-consuming. Long, low sensitivity, prone to false positive results and other defects, it is increasingly unable to meet the current detection needs

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Kit capable of performing semiquantitative detection on micro ribonucleic acid 100 (microRNA100) directly
  • Kit capable of performing semiquantitative detection on micro ribonucleic acid 100 (microRNA100) directly
  • Kit capable of performing semiquantitative detection on micro ribonucleic acid 100 (microRNA100) directly

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0036] Using microRNA100-3p (hereinafter referred to as microRNA100) as the target sequence, semi-quantitative analysis was performed on different levels of microRNA100 standards.

[0037] Step 1: Probe design and secondary structure prediction, the nucleotide sequence of microRNA100 is SEQ ID NO.3: 5'CAAGCTTGTATCTATAGGTATG 3', the nucleotide sequence and modification group of the A chain is SEQ ID NO.1: 5'ROXT C L TC L GGC ATACCTATAGATACAAGCTT GCCGAGT (-BHQ2)CTCCAGACGTCA

[0038] CTCAGTGCACC 3'. The single underlined sequence is complementary, the 5' end is modified with ROX (red fluorescent group), the double underlined T is modified with BHQ2 (fluorescent quencher group), the nucleotide with the upper right corner marked L is a locked nucleic acid, and the modification of the locked nucleic acid It is only used to increase the thermal stability of the probe's initial structure and reduce background fluorescence, and has no other effects. The prediction results of t...

Embodiment 2

[0046] The specificity of the probe was examined by using a mixture of high-concentration single-base mismatch sequences and double-stranded DNA identical to the microRNA100 sequence but twice its length as interfering substances.

[0047] Step 1: MicroRNA100 probe design and synthesis, see Step 1 and Step 2 of Example 1, the single-base mismatch nucleotide sequence is SEQ ID NO.4: 5'CAAGCTTGTAT T TATAGGTATG 3', compared with microRNA100 sequence, only one base T Differences. The sequence of the double-stranded DNA for interference is the DNA double helix structure formed by SEQ ID NO.5: 5'CAAGCTTGTATCTATAGGTATGCAAGCTTGTATCTATAGGTATG 3' and its complementary sequence.

[0048] Step 2: Take 1 μL of the probe with a concentration of 10 μmol / L and 18 μL of the hybridization buffer, a total of 19 μL, mix well and add to a 200 μL milky white eight-tube tube.

[0049] Step 3: Add 1 μL of microRNA100 standard substance to sample well A to make the content of microRNA100 in the samp...

Embodiment 3

[0053] The expression difference of microRNA100 in Hosepic cells and HIEC cells was detected.

[0054] Step 1: microRNA100 probe design and synthesis, see Step 1 and Step 2 of Example 1.

[0055] Step 2: Trizol method was used to extract total RNA from Hosepic cells and HIEC cells.

[0056] Step 3: Take 5 μL of the total RNA extracts from the above two samples and add them to 200 μL milky white eight-tube tubes.

[0057] Step 4: Add 1 μL of probe with a concentration of 10 μM and 14 μL of hybridization buffer, totaling 20 μL, mix well and send to qPCR instrument for detection.

[0058] Step 5: The detection condition is constant temperature at 60 ℃ for 30 minutes.

[0059] Step 6: Result analysis. Test results such as Figure 6 As shown, at 30 minutes, the fluorescence intensity of the sample containing the total RNA of Hosepic cells was about 8.0*10 6 , the fluorescence intensity of samples containing HIEC cell total RNA is about 7.0*10 6 Therefore, it is determined tha...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

A kit capable of performing semiquantitative detection on micro ribonucleic acid (microRNA) directly is used for performing semiquantitative detection on certain microRNA in total RNA. The kit capable of performing semiquantitative detection on microRNA directly comprises a probe with a single-side 3' suspending end double helix structure maintained by a multifunctional stem-loop structure and a hybrid buffer solution containing DNA chain replacement enzyme; the probe with the single-side 3' suspending end double helix structure maintained by a multifunctional stem-loop structure is formed by assembling a chain A and a chain B which have different lengths and are oligonucleotide single chains; and the chain A is long and the chain B is short. The original sample, namely total microRNA extracting liquid, is directly added into a detection system, reverse transcription and amplification on a target sequence are avoided, and the kit is low in detection limit, short in detection time and applied in the technical fields of medicine and molecular biology.

Description

technical field [0001] The invention relates to a kit capable of semi-quantitating microRNA100 directly in the technical fields of medicine and molecular biology. Background technique [0002] MicroRNA (miRNA) is a type of endogenous small RNA with a length of about 20-24 nucleotides, which plays an important role in important physiological and pathological processes such as cell development, apoptosis, differentiation, and proliferation. Studies have found that microRNAs widely exist in human body fluids such as blood, urine, saliva, amniotic fluid, and ascites. The specific microRNA expression profile is one of the specific biomarkers of tumor cells, and it is a new non-invasive diagnostic marker to help the prediction, diagnosis and prognosis of diseases. Traditional microRNA detection methods include Northern Blotting and the combined application of reverse transcription and real-time quantitative PCR (realtime PCR). These methods are relatively mature and widely used, ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12Q1/68
CPCC12Q1/6818C12Q2525/207C12Q2565/101C12Q2537/1376C12Q2563/107
Inventor魏敏杰张晶吴慧哲陈秋晨
Owner中国医科大学