Unlock instant, AI-driven research and patent intelligence for your innovation.

A detection method of sea urchin pathogen Vibrio fortis

A detection method, pathogenic bacteria technology, applied in biochemical equipment and methods, microbial measurement/inspection, etc., can solve problems that affect the accuracy of detection results, cumbersome operations, false positives, etc., achieve fast and efficient detection, avoid false positives, etc. Negative, ability-enhancing effects

Inactive Publication Date: 2020-06-16
DALIAN OCEAN UNIV
View PDF5 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0003] At present, most of the detection and identification of pathogenic bacteria in seafood are at the level of microbiological inspection, but they have disadvantages such as long cultivation period, cumbersome operation, and poor specificity; and the microorganisms available for cultivation in the natural environment are less than 1%. , which brings some difficulties to the detection of
Bacterial detection gene chips mostly use bacteriologically more conservative genes, such as 16SrRNA gene, but because of its fewer information sites, the stability of the constructed system is poor, and it is easy to produce deviations when used to identify bacteria with close kinship. , causing false positives and affecting the accuracy of the test results

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • A detection method of sea urchin pathogen Vibrio fortis
  • A detection method of sea urchin pathogen Vibrio fortis
  • A detection method of sea urchin pathogen Vibrio fortis

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0036] Design and synthesis of embodiment 1 probe

[0037] 1. Target detection strains and target genes

[0038] The present invention selects Vibrio carteri, an important common pathogenic bacterium in the sea urchin breeding area environment and organisms, as the detection object, and uses membrane protein as the target gene;

[0039] 2. Probe design

[0040] The present invention uses 18-30bp oligonucleotide probes. The basic requirement of probe parameters is specific and efficient hybridization, and the following conditions should be met: ①The Tm value of the probe should remain similar and fluctuate within a range of 10°C; ②The number of consecutive complementary bases that form dimers and hairpin structures Less than 4; ③ The number of consecutive matching bases between the probe and the non-target gene sequence is less than 7 bases; ④ The number of mismatched bases between the probe and the target gene is less than 4 bases.

[0041] The present invention designs 3 p...

Embodiment 2

[0048] The making of embodiment 2 gene chip

[0049] Utilize the probe designed in Example 1 to prepare the important common pathogenic bacteria Vibrio fortis in the sea urchin culture area environment and organisms, the specific steps are as follows:

[0050] 1. Preparation of probe mother solution

[0051] Dilute the synthesized probe (Table 2) into a 100 μmol / L mother solution with double distilled water, and then dilute it to a concentration of 20 μmol / L with a spotting buffer;

[0052] 2. Preparation before sampling

[0053] Transfer 100 μL to wells A1, B1 and C1 of a 96-well plate, and add 100 μL of spotting buffer to well D1;

[0054] 3. Spotting

[0055] Use the AD1500 gene chip spotting instrument of Bio-Dot Company of the United States to carry out non-contact spotting on the aldehyde substrate according to the pre-set program; the spotting volume of each point is 0.5 μL, the spot diameter is 200 μm, and the point spacing is 1.5 μL. mm, the relative humidity of t...

Embodiment 3

[0061] For the detection of the common pathogenic bacteria Vibrio fortis gene chip (prepared in Example 2) in the sea urchin breeding area environment and organisms, the specific steps are as follows:

[0062] 1. Collection and processing of samples to be tested

[0063] Use an 8 μm sterile filter membrane to remove impurities from the obtained water sample, then filter it with a 0.22 μm filter membrane and collect the filter membrane, wrap it in sterile aluminum foil, and store it at -20°C;

[0064] The mud sample is taken from 100g of sediment at the bottom 2-5cm of the breeding environment, and the collected samples are transported to the laboratory in an ice box;

[0065] Sea urchins (animal samples) were cut with sterile scissors, rinsed with sterile water three times, put into cryopreservation tubes, and stored in liquid nitrogen.

[0066] 2. Template DNA preparation

[0067]The DNA of water samples and mud samples was extracted with OMEGA Water DNA Kit (OMEGA Water DN...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to a detection method for sea urchin pathogenic bacteria strong vibrio. Three sets of probes VF2, VF3 and VF4 are used for detecting; the sequences of the probes are as follows: VF2(5'-3'): CGTTATCAACTTGCGATGCTGTAGGGGTG; VF3(5'-3'): CTTAGCTGCCTAACTTCTTGAGAACGAACCG; VF4(5'-3'): GGTGTCGTTAATAGCGGCATCTCTTGA. The method comprises the following steps: modifying the probes with amino groups, and then preparing into a gene chip; after extracting DNA of a to-be-detected sample, performing PCR amplification; performing fluorescence labeling; hybridizing with the gene chip and then utilizing a scanner to detect a result. The invention has the advantages that the method can be used for quickly and efficiently detecting the sea urchin pathogenic bacteria strong vibrio, the method has the characteristics of high specificity and sensibility, and the capacity of identifying the environment and organism pathogenic bacteria strong vibrio in a sea urchin culture zone is promoted.

Description

technical field [0001] The invention relates to a detection method of sea urchin pathogen Vibrio fortis. Background technique [0002] With the development of the sea urchin farming industry and the pollution of the breeding environment, the sea urchin farming industry is facing serious disease threats. Among them, Vibrio strongis is an important pathogen causing sea urchin bacterial diseases. [0003] At present, most of the detection and identification of pathogenic bacteria in seafood are at the level of microbiological inspection, but they have disadvantages such as long cultivation period, cumbersome operation, and poor specificity; and the microorganisms available for cultivation in the natural environment are less than 1%. , which brings some difficulties to the detection. Bacterial detection gene chips mostly use bacteriologically more conservative genes, such as 16SrRNA gene, but because of its fewer information sites, the stability of the constructed system is po...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Patents(China)
IPC IPC(8): C12Q1/689C12Q1/6837C12Q1/04
CPCC12Q1/6837C12Q1/689C12Q2531/113C12Q2565/501
Inventor 王荦常亚青丁君
Owner DALIAN OCEAN UNIV