Primer combination for identifying bovine viral diarrhea disease virus and bovine rotavirus and application thereof

A technology of bovine rotavirus and primer combination, applied in the direction of microorganism-based methods, microorganisms, recombinant DNA technology, etc., can solve the problems of inability to determine the positive results of pathogens and the inability to achieve differential diagnosis, etc.

Active Publication Date: 2017-07-28
GUANGXI VETERINARY RES INST
View PDF3 Cites 6 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, the current multiple LAMP methods in China have certain limitations, and it is impossible to determine which pathogen caused the positive result, and cannot achieve a true differential diagnosis.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Primer combination for identifying bovine viral diarrhea disease virus and bovine rotavirus and application thereof
  • Primer combination for identifying bovine viral diarrhea disease virus and bovine rotavirus and application thereof
  • Primer combination for identifying bovine viral diarrhea disease virus and bovine rotavirus and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0091] Embodiment 1, design and preparation of primer combinations

[0092] A large number of sequence analyzes and comparisons were carried out to obtain several primers for the identification of bovine viral diarrhea virus (BVDV) and bovine rotavirus (BRV). Preliminary experiments were carried out on each primer to compare performances such as sensitivity and specificity, and finally two sets of primers for identifying BVDV and BRV were obtained. Each set of primers consists of outer primer F3, outer primer B3, inner primer FIP (Flc+F2) and inner primer BIP (Blc+B2).

[0093] The primer set used to identify BVDV consists of the following four primers (5'→3'):

[0094] BVDV-F3 (SEQ ID NO: 1 of the SEQUENCE LISTING): TGCCCTTAGTAGGACTAGCA;

[0095] BVDV-B3 (SEQ ID NO: 2 of the SEQUENCE LISTING): AGCACCCTATCAGGCTGTA;

[0096] BVDV-FIP (SEQ ID NO: 3 of the SEQUENCE LISTING): CGAACCACTGACGACTACCCTGGGTAGCAACAGTGGTGAGTT;

[0097] BVDV-BIP (SEQ ID NO: 4 of the SEQUENCE LISTING): ...

Embodiment 2

[0108] Embodiment 2, establishment of detection method

[0109] 1. Use the RNA / DNA co-extraction kit to extract the nucleic acid of the sample to be tested.

[0110] 2. Take the nucleic acid obtained in step 1 as a template, and use the primer combination prepared in Example 1 to perform dual fluorescent RT-LAMP.

[0111] The initial reaction system is (25 μL): template 1 μL, 10×buffer 2.5 μL, Bst DNA polymerase 15U, AMV reverse transcriptase 20U, primer BVDV-FIP 40pmol, primer BVDV-BIP 40pmol, primer BRV-FIP 40pmol, primer BRV- BIP 40pmol, primer BVDV-F3 5pmol, primer BVDV-B3 5pmol, primer BRV-F3 5pmol, primer BRV-B35pmol, the balance is water.

[0112] The reaction program is: 42°C for 20min, 62°C for 90min, 80°C for 5min.

[0113] 3. Take the product of step 2, perform 1% agarose gel electrophoresis, and observe under ultraviolet lamps with wavelengths of 520nm and 670nm respectively.

Embodiment 3

[0114] Embodiment 3, specificity experiment

[0115] The samples to be tested are: bovine viral diarrhea virus Oregon strain in Table 1, bovine viral diarrhea virus GX-041 strain (BVDV-2 type), bovine rotavirus NCDV strain, bovine viral diarrhea virus Oregon strain and bovine rotavirus Mixture of viruses NCDV strains (mixture I), foot-and-mouth disease virus type A, vesicular stomatitis virus type NJ, vesicular stomatitis virus type IND, bluetongue virus serotype 4, Peste des petits ruminants virus Nigeria75 / 1 strain, bovine infection Rhinotracheitis virus and Mycoplasma bovis GL-1 strain.

[0116] Detection was carried out according to the method established in Example 2.

[0117] Set with ddH 2 0 was used as a template as a blank control for the sample to be tested.

[0118] The nucleic acid of bovine kidney cells (MDBK) was set as the negative control of the sample to be tested.

[0119] The result is as figure 2 shown. figure 2 A is the electropherogram of the 520n...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a primer combination for identifying bovine viral diarrhea disease virus (BVDV) and bovine rotavirus (BRV) and application thereof. The primer combination provided by the invention consists of single chain DNA molecules shown in sequences 1-8 in a sequence table; 5' end of a single chain DNA molecule shown in the sequence 3 is connected with fluorophore A, and 5' end of a single chain DNA molecule shown in the sequence 7 is connected with fluorophore B. According to the primer combination disclosed by the invention, the fluorophores are introduced into an LAMP method firstly, a dual-fluorescence RT-LAMP method for identifying BVDV and BRV can be established; by color observation of amplified products, two viruses can be simultaneously identified and diagnosed. The dual- RT-LAMP method built by the invention has good specificity, and can effectively amplify target genes without amplification to other pathogenic nucleic acid, so that the sensitivity is good, and 100 mixed template copy / reaction can be detected at minimum; therefore, the primer combination is a convenient, quick and low-cost diagnosis method, and is suitable for large-scale epidemiologic investigation.

Description

technical field [0001] The invention relates to a combination of primers for distinguishing bovine viral diarrhea virus and bovine rotavirus and its application. Background technique [0002] Bovine viral diarrhea virus (BVDV) and bovine rotavirus (Bovine Rotavirus, BRV) are two common bovine diarrhea viruses with similar symptoms and difficult to distinguish. Clinically, BVDV often presents with fever, diarrhea, mucosal injury, and toe injury, but most BVDV-infected cattle do not show clinical symptoms due to persistent infection. disease with a 100% mortality rate. Persistently infected cattle can transmit the virus horizontally through blood, excrement and other channels, and can also transmit the virus vertically through the reproductive tract. They carry the virus for life and continue to shed the virus, becoming an important source of infection and a potential hazard to the cattle industry. Bovine rotavirus infection of calves aged 1-7 days can cause digestive tract ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityApplications(China)
IPC IPC(8): C12Q1/70C12Q1/68C12N15/11C12R1/93
CPCC12Q1/6844C12Q1/701C12Q2531/119C12Q2537/143C12Q2563/107C12Q2521/107
Inventor谢芝勋范晴谢志勤谢丽基黄莉黄娇玲张艳芳曾婷婷王盛罗思思邓显文刘加波庞耀珊
OwnerGUANGXI VETERINARY RES INST