Method of producing tetrahydropyrimidine by fermenting recombinant corynebacterium glutamicum

A technology of Corynebacterium glutamicum and tetrahydropyrimidine, which is applied in the fields of genetic engineering and biological fermentation, can solve the problems of complicated separation process, increase production cost and the like, and achieve the effects of simplifying extraction process, simplifying fermentation process and reducing cost.

Active Publication Date: 2017-09-08
北京绿色康成生物技术有限公司
View PDF2 Cites 14 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, Escherichia coli can secrete endotoxin, and ectoine is mainly used in the field of cosmetics and medicine, so endotoxin must be removed, which makes the whole separation process more complicated and increases the production cost

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Method of producing tetrahydropyrimidine by fermenting recombinant corynebacterium glutamicum

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0029] Example 1 Overexpression of aspartokinase gene lysC that relieves feedback inhibition

[0030] The immediate precursor for the synthesis of ectoine is aspartate, and aspartokinase, the first enzyme in the synthesis pathway from aspartate to ectoine, is feedback-inhibited by lysine and threonine. Therefore, the present invention removes the feedback inhibition of the enzyme by lysine and threonine at first by introducing site-directed mutation Q298G in the aspartokinase gene, and inserts a strong promoter P1( The sequence is 5'-ggtgcacaaagCAAAAGCTGGGTACCCTATCTGGTGCCCTAAACGGGGGAATATTAACGGGCCCAGGGTGGTCGCACCTTGGTTGGTAGGAGTAGCATGGGATCC-) (SEQ ID NO. 4) to enhance the expression of the gene. The specific implementation process is as follows:

[0031]Using the genome of Corynebacterium glutamicum MB001 (Baumgart M et al, Appl Environ Microbiol 79:6006-15 (2013)) as a template, primers lysC-1-F (aggaaacagctatgacatgattacgtttcgcccagaaccaagtagcc) and lysC-1-R (CCCAGCTTTTGctttgtgc...

Embodiment 2

[0032] Example 2 Promoter replacement weakens the expression of dihydropyrimidinedicarboxylate synthase gene dapA

[0033] Since the main fermentation product of the recombinant strain C. glutamicum lysC-P1-298 is lysine, in order to make more substrates for the synthesis of ectoine, the expression of the dihydropyrimidinedicarboxylate synthase gene dapA was further weakened.

[0034] Using the genome of Corynebacterium glutamicum MB001 as a template, PCR was performed with primers dap-1-F (ctatgacatgattacgaattcagatggttttcctgaccagctt) and dap-1-R (gggaagaaggaaaccttgaactctatgagcacagg) to obtain a gene fragment dap1 of about 1.0 kb and purify the PCR product. Using the genome of Corynebacterium glutamicum MB001 as a template, PCR was performed with primers dap-2-F (ttcaaggtttccttcttccctcatttggggg) and dap-2-R (tgcctgcaggtcgactctagaggcctgtaaaggctcatttcag) to obtain a gene fragment dap2 of about 1.0 kb and purify the PCR product. The Corynebacterium glutamicum suicide plasmid pK18...

Embodiment 3

[0035] Example 3 Overexpression of ectABC, a gene related to the synthesis pathway of ectoine

[0036] In order to strengthen the expression of key genes in the ectoine synthesis pathway, the ectABC gene was artificially synthesized, the sequence of which is shown in SEQID NO.3. Halomonas elongata DSM2581 genome was subjected to PCR using primers ectABC-F (tgcatgcctgcaggtcgactAGGAGGCCCTTCAGatgaacg) and ectABC-R (ccgccaaaacagccaagctgttacagcggcttctggtcgt) as primers to obtain a gene fragment ectABC of about 2.5kb and purify the PCR product. The Corynebacterium glutamicum expression plasmid pXMJ19 (purchased from addgene) was double digested with EcoRI / XbaI, and the ectABC gene fragment was ligated to pXMJ19 in one step using the Gibson Assembly kit (NEB). The obtained recombinant plasmid was named pXMJ-ectABC. Using an electroporator (Bio-Rad), transfer pXMJ-ectABC into Corynebacterium glutamicum lysC-dap by electroporation, the electric shock conditions are voltage 2.5KV, resis...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention provides a method of producing tetrahydropyrimidine by fermenting recombinant corynebacterium glutamicum. The recombinant corynebacterium glutamicum is obtained by the steps of performing overexpression in corynebacterium glutamicum to relieve an aspartokinase gene lysC of feedback inhibition; then replacing a promoter of a dihydropyrimidine dicarboxylic acid synthetase in the recombinant bacteria to weaken the activity of the dihydropyrimidine dicarboxylic acid synthetase; and then transferring tetrahydropyrimidine synthetic path related gene ectABC into the recombinant bacteria to obtain the recombinant corynebacterium glutamicum. The recombinant corynebacterium glutamicum provided by the invention can use different cheap raw materials to produce tetrahydropyrimidine by fermentation under a low salt condition, and cheap corn slurry can be also used as a nutritional component which replaces expensive yeast powder, so that the cost of the raw materials is further lowered. Meanwhile, the recombinant corynebacterium glutamicum provided by the invention solves the problem of biosafety, simplifies the post-extraction process and has a good market application prospect.

Description

technical field [0001] The invention belongs to the technical field of genetic engineering and biological fermentation, and in particular relates to a method for fermenting and producing ectoine with food-safe microorganism recombinant Corynebacterium glutamicum. Background technique [0002] Ectoine, a cyclic amino acid derivative, is a compatible solute produced in cells by many salt-tolerant microorganisms to maintain osmotic pressure balance, and is important for the stress resistance of cells / enzymes It can alleviate the toxic effects of hypertonicity, high temperature, freeze-thawing, drying, radiation and chemical reagents on proteins, nucleic acids, biofilms and the entire cell. Therefore, ectoine has been widely used in the fields of cosmetics, medicine, and enzyme preparations, and has broad market prospects. [0003] At present, the production method of ectoine is mainly obtained by high-density fermentation of halophilic microorganisms, especially Halomonas. Th...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityApplications(China)
IPC IPC(8): C12N1/21C12N15/54C12N15/60C12N15/31C12N15/77C12P17/12C12R1/15
CPCC12N9/1217C12N9/88C12N15/77C12P17/12C12Y207/02004C12Y402/01C07K14/34C12Y403/03007C12N1/20C12N9/1029C12N9/1096C12N15/52C12N1/205C12R2001/15
Inventor陈振刘德华
Owner北京绿色康成生物技术有限公司