Recombinant oncolytic virus, and application thereof
An oncolytic virus and virus technology, applied in the fields of biotechnology and gene therapy, can solve the problems that T cells cannot play the role of killing and anti-tumor, and achieve enhanced tumor cell targeting, strong tumor lysis ability, large The effect of clinical application prospect
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0037] Embodiment 1: Preparation of recombinant poxvirus OVV-TABS-HER2
[0038] 1. Construction of fusion gene TABS-HER2
[0039] DsRed-Psel-HindIII-PF17R-TABS-HER2 was synthesized, and multiple cloning sites Not I and EcoR V were introduced at both ends. The specific sequence of the TABS-HER2 gene is shown in SEQ ID NO.I. The gene was entrusted to Shanghai Rui Crystal Biotechnology Co., Ltd., and cloned into the pSEL2N1 vector through the NotI and EcoRV multiple cloning sites to obtain the recombinant plasmid pSEL2N1-TABS-HER2-DsRed.
[0040] SEQ ID NO.1: (TABS-HER2 nucleotide sequence)
[0041] ATGGACTGGATCTGGCGCATCCTCTTCCTCGTCGGCGCTGCTACCGGCGCTCATTCTGAGGTACAACTGCAGCAGTCTGGACCTGAACTGAAGAAGCCTGGAGAGACAGTCAAGATCTCCTGCAAGGCCTCTGGGTATCCTTTCACAAACTATGGAATGAACTGGGTGAAGCAGGCTCCAGGACAGGGTTTAAAGTGGATGGGCTGGATTAACACCTCCACTGGAGAGTCAACATTTGCTGATGACTTCAAGGGACGGTTTGACTTCTCTTTGGAAACCTCTGCCAACACTGCCTATTTGCAGATCAACAACCTCAAAAGTGAAGACATGGCTACATATTTCTGTGCAAGATGGGAGGTTTACCACGGCTACGTTCCTTACTGGGGCC...
Embodiment 2
[0054] Example 2: PCR amplification of recombinant oncolytic virus insertion gene
[0055] Take 10 µL of the virus lysate of recombinant oncolytic poxvirus OVV-TABS-HER2, and use the viral genomic DNA purification kit (purchased from TakaRa Company) to prepare recombinant poxvirus genomic DNA. The specific operation method refers to the instruction manual. After measuring the concentration of the obtained genomic DNA, take 5 ng as a template, and use the upstream and downstream primers to amplify the target DNA fragment. The sequence of the upstream primer is: 5'-cggcggacatattcagttgataatcgg-3'; the sequence of the downstream primer is: 5'-gtttgccatacgctcacag-3' , The PCR amplification program is: 94°C, 5m; 94°C, 30s, 58°C, 30s; 72°C, 3m; 72°C, 5m; 30 cycles. The PCR product was detected by 1% agarose electrophoresis to analyze the size of the insert (for the results, see Figure 5 ).
Embodiment 3
[0056] Embodiment 3: Amplification and purification of recombinant poxvirus
[0057] HuTK-143B cells were inoculated in T175 culture flasks, cultured at 37°C until 95% confluence (confluence), respectively inoculated with OVV-TABS-HER2 or OVV-GFP-RFP virus according to MOI = 0.1, and cultured at 37°C for 48-72h to the cells With complete CPE lesions (cytopathic effect), cells were harvested. The cell pellet was collected at 400g and 10m, and the cell pellet was resuspended in 1mM Tris pH 9.0 solution, freeze-thawed three times at -80°C, and purified by ultracentrifugation with a sucrose cushion (Sucrose cushion) solution.
PUM
Abstract
Description
Claims
Application Information
- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap