Unlock instant, AI-driven research and patent intelligence for your innovation.

Recombinant oncolytic virus, and application thereof

An oncolytic virus and virus technology, applied in the fields of biotechnology and gene therapy, can solve the problems that T cells cannot play the role of killing and anti-tumor, and achieve enhanced tumor cell targeting, strong tumor lysis ability, large The effect of clinical application prospect

Pending Publication Date: 2017-09-15
镇江市卫克生物科技有限公司
View PDF5 Cites 12 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Without these two prerequisites, tumor-infiltrating T cells (TILs) cannot exert anti-tumor effects
Tumor cells often evade the killing effect of T cells by down-regulating MHC molecules to achieve the purpose of immune escape, so that T cells infiltrated by tumor tissue cannot play a killing role.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Recombinant oncolytic virus, and application thereof
  • Recombinant oncolytic virus, and application thereof
  • Recombinant oncolytic virus, and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0037] Embodiment 1: Preparation of recombinant poxvirus OVV-TABS-HER2

[0038] 1. Construction of fusion gene TABS-HER2

[0039] DsRed-Psel-HindIII-PF17R-TABS-HER2 was synthesized, and multiple cloning sites Not I and EcoR V were introduced at both ends. The specific sequence of the TABS-HER2 gene is shown in SEQ ID NO.I. The gene was entrusted to Shanghai Rui Crystal Biotechnology Co., Ltd., and cloned into the pSEL2N1 vector through the NotI and EcoRV multiple cloning sites to obtain the recombinant plasmid pSEL2N1-TABS-HER2-DsRed.

[0040] SEQ ID NO.1: (TABS-HER2 nucleotide sequence)

[0041] ATGGACTGGATCTGGCGCATCCTCTTCCTCGTCGGCGCTGCTACCGGCGCTCATTCTGAGGTACAACTGCAGCAGTCTGGACCTGAACTGAAGAAGCCTGGAGAGACAGTCAAGATCTCCTGCAAGGCCTCTGGGTATCCTTTCACAAACTATGGAATGAACTGGGTGAAGCAGGCTCCAGGACAGGGTTTAAAGTGGATGGGCTGGATTAACACCTCCACTGGAGAGTCAACATTTGCTGATGACTTCAAGGGACGGTTTGACTTCTCTTTGGAAACCTCTGCCAACACTGCCTATTTGCAGATCAACAACCTCAAAAGTGAAGACATGGCTACATATTTCTGTGCAAGATGGGAGGTTTACCACGGCTACGTTCCTTACTGGGGCC...

Embodiment 2

[0054] Example 2: PCR amplification of recombinant oncolytic virus insertion gene

[0055] Take 10 µL of the virus lysate of recombinant oncolytic poxvirus OVV-TABS-HER2, and use the viral genomic DNA purification kit (purchased from TakaRa Company) to prepare recombinant poxvirus genomic DNA. The specific operation method refers to the instruction manual. After measuring the concentration of the obtained genomic DNA, take 5 ng as a template, and use the upstream and downstream primers to amplify the target DNA fragment. The sequence of the upstream primer is: 5'-cggcggacatattcagttgataatcgg-3'; the sequence of the downstream primer is: 5'-gtttgccatacgctcacag-3' , The PCR amplification program is: 94°C, 5m; 94°C, 30s, 58°C, 30s; 72°C, 3m; 72°C, 5m; 30 cycles. The PCR product was detected by 1% agarose electrophoresis to analyze the size of the insert (for the results, see Figure 5 ).

Embodiment 3

[0056] Embodiment 3: Amplification and purification of recombinant poxvirus

[0057] HuTK-143B cells were inoculated in T175 culture flasks, cultured at 37°C until 95% confluence (confluence), respectively inoculated with OVV-TABS-HER2 or OVV-GFP-RFP virus according to MOI = 0.1, and cultured at 37°C for 48-72h to the cells With complete CPE lesions (cytopathic effect), cells were harvested. The cell pellet was collected at 400g and 10m, and the cell pellet was resuspended in 1mM Tris pH 9.0 solution, freeze-thawed three times at -80°C, and purified by ultracentrifugation with a sucrose cushion (Sucrose cushion) solution.

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention belongs to the fields of biotechnology and gene therapy, and concretely to a recombinant oncolytic virus, and an application thereof. The recombinant oncolytic virus is a oncolytic virus carrying a TABS fusion protein gene, one end of the TABS fusion protein can specifically bind to tumor antigens, and the other end of the TABS fusion protein can specifically bind to the TCR of T cells. The single-chain fusion protein comprises a single chain antibody (scFv) which can specifically recognize a tumor associated antigen (TAA) or a tumor specific antigen (TSA), a linker polypeptide and a superantigen which specifically binds to a TCR complex or component from the amino terminal to the carboxy terminal, and a virus promoter in front of the TABS fusion protein gene is F17R. OVV-TABS prepared in the invention effectively combines the oncolytic effect of the virus and the anticancer effect of T cells, and has a remarkable anticancer effect, so the oncolytic virus has great clinical application prospect.

Description

technical field [0001] The invention belongs to the fields of biotechnology and gene therapy, and specifically relates to a recombinant oncolytic virus and its application. Background technique [0002] Cancer seriously threatens human health and life. Conventional treatment options are surgery, radiotherapy, and chemotherapy, but most cancer patients have missed the best treatment period when they are diagnosed and are not suitable for surgery. The side effects of radiotherapy and chemotherapy are obvious and insensitive, and the "live drug" of targeted immunotherapy has gradually become one of the cancer treatment strategies. Oncolytic virus (OV) is a kind of virus that selectively replicates and proliferates in tumor cells after genetic modification, and after lysing tumor cells, the progeny virus can spread to adjacent tumor cells. It has gradually become the target of tumor-targeted immunotherapy One of the "living medicines". At present, there are more than ten kind...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N7/01C12N15/62C07K19/00A61K35/76A61P35/00
CPCA61K35/76C07K16/32C07K2317/622C07K2319/33C12N7/00C12N2710/24021Y02A50/30
Inventor 于峰
Owner 镇江市卫克生物科技有限公司
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More