Heparin precursor synthase and application thereof

A heparin precursor and sequence technology, which is applied to heparin precursor synthase and its application field, can solve the problems of large molecular weight, disadvantage, influence polymerization rate and efficiency, etc., and achieve the effect of reducing molecular weight and high efficiency

Active Publication Date: 2017-09-22
JIANGNAN UNIV
View PDF4 Cites 3 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

The difference is that although the heparin precursor synthase PmHS derived from P. multocida is a bifunctional glycosyltransferase, that is, it has the function of transporting UDP-GlcUA and UDP-GlcNAc at the same time, and the protein is small (652 amino acids), but PmHS The molecular weight of the synthetic heparin precursor is 200-300kDa, the molecular weight is too large, which is far from the natural heparin derived from animals, especially in the market today, low molecular weight heparin or ultra-low molecular weight heparin has a longer half-life and better biological properties. Subcutaneous utilization is more concerned, so it is not conducive to downstream sulfation modification to obtain commercial heparin drugs
Although E.coliK5 avoids this problem, the two independent glycosyltransferases KfiC and KfiA derived from it, their attachment position and distance on the cell membrane are not necessarily optimal, and this factor may affect the polymerization rate and efficiency,

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Heparin precursor synthase and application thereof
  • Heparin precursor synthase and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0033] Example 1 Construction of Escherichia coli K5 heparin precursor synthase KfiC and KfiA co-expression recombinant plasmid

[0034]α-glycosyltransferase encoding gene kfiA and β-glycosyltransferase encoding gene kfiC are derived from Escherichia coli K5 (E.coli O10:K5:H4, E.coli K5), E.coli K5 strain was inoculated in 5mL LB liquid Medium, cultivated at 37°C 200rpm for 16h. The bacteria were collected, and the genomic DNA of the E.coli K5 strain was extracted using a bacterial genome extraction kit.

[0035] Primers KfiA-F1 / KfiA-R1, KfiC-F1 / KfiC-R1 were designed respectively, and the extracted genomic DNA was used as a template to amplify the target gene using standard PCR amplification system and procedures.

[0036] Primer sequence information: 5'-3' direction

[0037] KfiA-F1: GGTAAGAGAGGAATGTACACATGATTGTTGCAAATATGTC

[0038] KfiA-R1: CCGCTCGAG TTACCCTTCCACATTATACA

[0039] KfiC-F1: CGGGGTACC ATGAACGCAGAATATATAAATTTAG

[0040] KfiC-R1:GTGTACATTCCTCTCTACCCTATTG...

Embodiment 2

[0042] Example 2 Escherichia coli K5 heparin precursor synthases KfiC and KfiA through a flexible linker (GGGGS) 2 Connection construction

[0043] Using the above-mentioned recombinant plasmid pP43NMK-kfiC-RBS-kfiA as a template, design primers KfiA-F2 / KfiA-R1, KfiC-F1 / KfiC-R2 respectively, and use standard PCR amplification system and program to amplify and obtain the target gene.

[0044] Primer sequence information: 5'-3' direction

[0045] KfiA-F2: GGTGGCGGTGGCTCGGGCGGTGGTGGGTCGATGATTGTTGCAAATATGTC

[0046] KfiC-R2:CGACCCCACCACCGCCCGAGCCACCGCCACCTTGTTCAATTATTTCCTGATA

[0047] KpnI restriction enzyme sites and (GGGGS) were introduced at both ends of the upstream and downstream primers of kfiC, respectively. 2 linker sequence, and remove the stop codon of kfiC. Introduce (GGGGS) at both ends of the upstream and downstream primers of kfiA 2 linker sequence and XhoI restriction enzyme site. The obtained kfiC and kfiA fragments were amplified by PCR (GGGGS) 2 In the ove...

Embodiment 3

[0048] Example 3 Construction of fusion of Escherichia coli K5 heparin precursor synthase KfiC and KfiA

[0049] Using the recombinant plasmid pP43NMK-kfiC-RBS-kfiA as a template, primers KfiA-F3 / KfiA-R1 and KfiC-F1 / KfiC-R3 were designed respectively, and the target gene was amplified using standard PCR amplification system and procedures.

[0050] Primer sequence information: 5'-3' direction

[0051] KfiA-F3: AGATGTATCAGGAATAATTGAACAAATTGTTGCAAATATGTCATC

[0052] KfiC-R3:TTGTTCAATTTATTCCTGATA

[0053] The KpnI restriction site and the 20 bp sequence of kfiA after the start codon ATG (excluding ATG) were respectively introduced at both ends of the upstream and downstream primers of kfiC, and the stop codon of kfiC was removed. An XhoI restriction enzyme site was introduced at the 5' end of the kfiA downstream primer. After PCR amplification of the obtained kfiC and kfiA fragments, the two fragments were fused by 20bp overlapping PCR to obtain the fragment KpnI-kfiC-kfiA-Xho...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a heparin precursor synthase and application thereof and belongs to the technical field of bioengineering. Heparin precursor synthases KfiC and KfiA from escherichia coli K5 are modified in three ways in bacillus subtilis, i.e., the two synthases are directly fused; the two synthases are connected through a flexible linker; and key areas in the KfiC and KfiA replace a key area of a PmHS synthase from pasteurella multocida to obtain three novel heparin precursor synthases, and the results that the yield of heparin precursors is improved and the molecular weight of the heparin precursors is reduced are realized. The invention lays a foundation for efficiently producing and preparing the heparin precursors from food grade microorganisms, and the heparin precursor synthase is suitable for industrial production and application.

Description

technical field [0001] The invention relates to a heparin precursor synthase and its application, belonging to the technical field of bioengineering. Background technique [0002] Heparin belongs to a class of highly sulfated glycosaminoglycans (GAGs) with unique physiological functions. As an anticoagulant and antithrombotic drug, heparin is used in medical measures such as deep vein thrombosis, renal dialysis and indwelling catheter shunt, and postoperative thrombus control. Due to its complex structure and diverse biological activities, the research and development of heparin has become a hot spot in the research of polysaccharide drugs in recent years. At present, heparin mainly relies on the extraction of animal tissues, but with the increasing demand for heparin, only relying on the preparation of animal tissues cannot meet the demand. The safety of obtaining heparin has been questioned. Therefore, using safe and effective chemical enzymatic synthesis of heparin has...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N9/10C12N15/54C12N15/75C12N1/21C12P19/26C12R1/125
Inventor康振陈坚堵国成张琳培王浩
OwnerJIANGNAN UNIV