Recombinant plasmid, construction method and accurate genome transformation for mycobacterium
A technology of mycobacteria and recombinant plasmids, which is applied in the direction of plant genetic improvement, genetic engineering, recombinant DNA technology, etc., and can solve the problems of difficulty in obtaining target DNA strains and low efficiency
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0086] Example 1 Construction of a basic plasmid for precise genome editing based on mycobacteria
[0087] Such as figure 1 The method process shown is as follows:
[0088] Step 1. Use BglII and NheI to double digest pEN4.1A-T10M plasmid (pEN4.1A-T10M plasmid is an existing technology and can be obtained through purchase) to obtain Pimyc-tetRDNA fragment.
[0089] The pBlueScript SK(-) plasmid was digested with BamHI and XbaI (the pBlueScript SK(-) plasmid is an existing technology and can be obtained through purchase), and the Pimyc-tetRDNA fragment was added and ligated pKS-Pimyc-tetR .
[0090] Step 2. Based on the I-sceI gene, on the basis of comprehensive analysis of the codon usage of Mycobacterium tuberculosis, Mycobacterium smegmatis and Mycobacterium fortuitum, the gene designer software is used to optimize the synthesis of I- The scel gene was named sceM (702bp, SEQ ID NO: 1). Use NdeI and KpnI double enzyme digestion of pLU101 plasmid (it is the prior art, disclosed in:...
Embodiment 2
[0102] This embodiment is an alternative technical solution of Embodiment 1. The only distinguishing technical measures are:
[0103] Using chromosomal DNA of Mycobacterium tartaricum as template, using primers
[0104] psmyc_F: tttaAGATCTGGATCGTCGGCACCGTCA and
[0105] psmyc_R: tttaGGTACCGGAT CGTGCTCATTTCGGGC, a Psmyc promoter fragment of about 300 bp was obtained by PCR, which was digested and cloned into pEN4.1A-T10M plasmid using BglII and kpnI, which can replace Pimyc promoter.
[0106] Because the tetracycline-induced promoter has the problem of background expression and induction efficiency, the two need to be balanced. The main purpose is to regulate the background expression efficiency of the sceM gene, but the above two promoters can be used normally after replacement.
Embodiment 3
[0108] Example 3 Construction Accurately knock out the targeting plasmid pMK5228 of MSMEG_5228
[0109] Such as image 3 As shown, the construction flow chart of pMK5228 plasmid, the construction process is as follows:
[0110] (1) Use (primer
[0111] SC_U_F:tttagaattcAACCCGGTGTGCGATCTGGT,
[0112] SC_U_R: ATCGCAGATGTCGCCCGTG;
[0113] SC_D_R1: ACCCTGTTATCCCTAGGGTTCTGCGAGGACGACA,
[0114] SC_D_R:GGGTTCTGCG AGGACGACA,
[0115] SC_D_R3: atttTCTAGAGCGTTAATTAAACTAGTAGATCTAAGCTTGATTACCCTGTTATCCCTAGGGTTCTGCG AGGACGACA)
[0116] PCR integration to obtain knockout recombination exchange arms of 820bp and 946bp upstream and downstream of MSMEG_5228 respectively, HindⅢ and EcoRI digestion with HindⅢ and EcoRI double digestion pMK101( Obtained from the construction method of Example 1 ) Ligation to obtain pMK1011 plasmid. The apramycin resistance gene of pIJ773 plasmid was obtained by digestion with XbaI, and cloned into pMK1011 plasmid to obtain plasmid pMK1012. PacI digests pGOAL19 plasmid (pG...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More 


