Beta-glucosidase, preparation method and application thereof

A technology of glucosidase and ginsenoside, applied in the direction of botany equipment and methods, biochemical equipment and methods, applications, etc., can solve the problems of many by-products and harmful environment, and achieve less by-products, low cost and high yield high effect

Active Publication Date: 2017-11-24
JILIN AGRICULTURAL UNIV
View PDF2 Cites 14 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0004] The purpose of the present invention is to provide a kind of β-glucosidase and its preparation method and application in order to solve the problem that the existing method of hydrolyzing saponin has many by-products and is harmful to the environment

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Beta-glucosidase, preparation method and application thereof
  • Beta-glucosidase, preparation method and application thereof
  • Beta-glucosidase, preparation method and application thereof

Examples

Experimental program
Comparison scheme
Effect test

preparation example Construction

[0038] The present invention also provides a preparation method of β-glucosidase, the method comprising:

[0039] The DNA fragment shown in SEQ ID NO. 2 is inserted into an expression vector to obtain a recombinant vector, the recombinant vector is transformed into a host cell, the transformant is cultured, and β-glucosidase is obtained from the culture.

[0040] According to the present invention, the described preparation method steps are as follows:

[0041] Step 1: Take the genomic DNA extracted from Thermotoga neapolitana DSM 4359 as a template, use the upstream primer with the nucleotide sequence shown in SEQ ID NO.3 and the downstream primer with the nucleotide sequence shown in SEQ ID NO.4. PCR amplification to obtain the DNA molecule shown in SEQ ID NO.2; the amplification conditions are preferably: 95°C pre-denaturation for 4min, then 95°C for 50s, 55°C for 45s, 72°C for 1min 30s, a total of 30 cycles , and finally extended at 72°C for 10 min, the above PCR reaction...

Embodiment 1

[0051] Example 1 Preparation of β-glucosidase

[0052] The genomic DNA of Thermotoga neapolitana DSM 4359 (sourced from the German Collection of Microorganisms, No. 4359) was extracted and used as a template. P1 and P2 were used as primers. The primers were synthesized by Shanghai Sangon Bioengineering Technology Service Co., Ltd. The primer sequences as follows:

[0053] P1:

[0054] 5’-CGCGGCAGCCATATG GCTAGC ATGAAGATGGAAAAGGTGAATGA-3’

[0055] (forward), the underline indicates the Nhe I site (the P1 nucleotide sequence is shown in SEQ ID NO.3);

[0056] P2:

[0057] 5’-TTGTCGACGGAGCTC GAATTC TCACGGTTTGAATCTTCTCTCCT3’

[0058] (reverse), the underline indicates the Ecor I site (the P2 nucleotide sequence is shown in SEQ ID NO. 4);

[0059] Use the upstream primer with the nucleotide sequence shown in SEQ ID NO.3 and the downstream primer with the nucleotide sequence shown in SEQ ID NO.4 to carry out PCR amplification. Then 95°C for 50s, 55°C for 45s, 72°C for 1min ...

Embodiment 2

[0063] Example 2 Determination of the enzymatic properties of β-glucosidase

[0064] Enzyme activity was defined as the amount of enzyme required to catalyze the production of 1 μmol of p-nitrophenol (pNP) within 1 min.

[0065] 1. Determination of the optimal reaction temperature of β-glucosidase

[0066] The enzyme activity of the diluted enzyme solution at pH 5.0 and temperature of 40-100℃ was measured respectively. Three parallels were set for each temperature. The highest enzyme activity was set as 100%, and the relative enzyme activity was plotted against temperature. The result is as figure 1 shown.

[0067] from figure 1 It can be seen that the optimum reaction temperature of the β-glucosidase of the present invention is 85°C.

[0068] 2. Determination of the optimum reaction pH of β-glucosidase

[0069] 50 mM buffers (pH range 3.0-10.0) with different pH were taken to prepare 5 mM pNPG solution, 25 μL of diluted enzyme solution was added, and three parallels were...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention provides a beta-glucosidase, a preparation method and application of beta-glucosidase, belonging to the field of genetic engineering technology and biological medicine. The beta-glucosidase is selected from the protein shown as (1) or (2) as follows: (1) the protein with amino acid sequence shown as SEQ ID NO.1 and (2) the protein with glycosidase activity and with one / more amino acid residue substituted and / or deleted and / or added in the amino acid residue sequence. The beta-glucosidase provided by the invention has high heat stability and wide pH enzymolysis scope, can be used for producing rare ginsenoside and mixture thereof, has relatively high hydrolysis capacity, is capable of converting the ginsenoside into the rare ginsenoside which has relatively high biological activity, is capable of being easily efficiently absorbed by a human body and has trace volume in the plants such as ginseng, and can be applied to various fields of food, medicine health, and the like.

Description

technical field [0001] The invention belongs to the field of genetic engineering technology and biomedicine, and particularly relates to a beta-glucosidase and a preparation method and application thereof. Background technique [0002] The main active components of ginseng are ginsenosides. Ginsenoside is a glycoside compound formed by connecting sugar and aglycone, and belongs to triterpenoid saponins. The most abundant ginsenosides are protopanaxadiol saponins and protopanaxtriol saponins, protopanaxadiol saponins include ginsenosides Rb1, Rb2, Rc, Rd, F2, Rg3, Rh2, Ginsenoside compound K (CK), etc.; protopanaxatriol-type saponins include ginsenosides Re, Rg1, Rf, Rg2, Rh1 and the like. Among them, the content of ginsenosides Rb1, Rb2, Rc, Re, Rg1, and Rd is relatively high, while the content of ginsenosides Rg2, Rg3, Rh1, Rh2, CK, etc. in natural ginseng is only a few parts per 100,000 or does not exist, which is a rare ginseng saponins. Many pharmacological studies h...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N9/42C12N15/56C12N15/70C12N1/21C12P33/20C12P33/00
CPCC12N9/2445C12P33/00C12P33/20C12Y302/01021
Inventor毕云枫刘景圣郗昕
OwnerJILIN AGRICULTURAL UNIV