Lentiviral expression vector for inducing hpv16 E6/E7 gene expression under hypoxic conditions
A technology of HPV16E6 and expression vectors, which is applied in the field of hypoxia-induced expression of lentiviral expression vectors, can solve problems such as leakage, and achieve the effects of improving efficiency, avoiding immunogenic reactions, and improving survival adaptability
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0035] Example 1 Hypoxia induces CD34 + Differentiation of hematopoietic progenitors into immortalized erythroid progenitors
[0036] 1. Construction of pFUGW-HRE-E6 / E7 vector
[0037] Nine copies of the hypoxia response element Epo HRE sequence (CCGGGTAGCTGGCGTACGTGCTGCAG) were coupled to the CMV minimal promoter and linked to the HPV16 E6 / E7 and SV40 polyadenylation signals (polyA). Then the expression cassette containing 9 copies of the HRE sequence (H9), CMV minimal promoter, HPV16 E6 / E7 and SV40 polyadenylation signal (polyA) was cloned into the 2597-4160 site of the lentiviral vector pFUGW (Addgene) During this period, the pFUGW-H9-E6 / E7 vector was generated, and the construction map is shown in figure 1 . figure 1 Middle, HRE: hypoxia response element, CMVminPro: cytomegalovirus minimal promoter, human papillomavirus E6 / E7 gene, Ubc is Ubiqutin promoter; EGFP is green fluorescent gene, WPRE is woodchuck hepatitis virus post-transcriptional regulatory element . fig...
Embodiment 2
[0045] Example 2. Immortalization and differentiation of erythroid progenitor cells into mature erythrocytes
[0046] Immortalized erythroid progenitor cells induced under hypoxic conditions stopped hypoxic culture after 100 days of culture and were transferred to erythroid terminal differentiation culture conditions for culture. The speed of obtaining terminal red blood cells is basically close to the speed of direct differentiation of stem cells into red blood cells. Specific steps are as follows:
[0047] Transfer the immortalized erythroid progenitor cells to basal medium at 37°C in 94% N 2 , 5% CO 2 and 1%O 2 cultured under hypoxic conditions for 8 days. The basal medium was changed to differentiation medium (basal medium supplemented with 500 ug / ml heparin but without SCF and IL-3). And under normal oxygen supply conditions (95% air and 5% CO 2 ). On day 6, the cell concentration was maintained at 1-2 × 10 5 / ml, add fresh medium to maintain the cell concentratio...
Embodiment 3
[0053] Example 3. Functional evaluation of induced erythrocytes
[0054] Use Hemox Analyzer (TCS Scientific Corp) to measure the oxygen binding capacity of the erythrocytes induced by the present invention, fully oxidize the cultured blood cells in the air, then completely deoxygenate in the nitrogen box, and use the Clark oxygen electrode probe to measure the oxygen tension in aerobic and anaerobic conditions. The degree of change between oxygen, while recording the wavelength value of oxyhemoglobin in dual-wavelength spectrophotometry. Human peripheral whole blood was used as a control. The degree of deformation was measured using ARCR (Automated Rheoscope and cellanalyzer).
[0055] Immortalized cells terminate immortalization under aerobic conditions, and differentiate into mature anucleated red blood cells-reticulocytes under terminal red blood cell differentiation conditions, which account for about 42% of the total cells. These cells contain 86-88% adult hemoglobin an...
PUM

Abstract
Description
Claims
Application Information

- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com