Eureka AIR delivers breakthrough ideas for toughest innovation challenges, trusted by R&D personnel around the world.

Detection primers and method for yak, cattle and buffalo derived components in beef food

A detection method, the technology of yak, applied in the field of genetic engineering, can solve the problems of false positive detection results, long operation time, complicated operation, etc., and achieve the effect of improving accuracy, avoiding false positives, and good technical guarantee

Pending Publication Date: 2018-03-30
SICHUAN LIGHT INDUSTRY RESEARCH AND DESIGN INST
View PDF4 Cites 6 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0003] The shortcomings of the existing technology mainly include the following three points: first, the cost is high, and the Taqman probe technology is used to detect three kinds of bovine-derived components respectively, and three pairs of different primers and probes need to be synthesized, and three times the amount of PCR master mix is ​​used And three times the amount of PCR plates, the cost is high
Second, poor specificity and more false positives
According to the import and export industry standards formed by the existing technology, the specificity of the primers and probes has obvious non-specific amplification, and the Taqman hydrolysis probe itself has no PCR amplification and still falls off the fluorescent group to excite the fluorescent signal The defects of the test result make the false positive result very serious
Third, the operation is complicated and time-consuming
Since three different PCR system solutions are prepared for each sample to be tested, the operation time is long

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Detection primers and method for yak, cattle and buffalo derived components in beef food
  • Detection primers and method for yak, cattle and buffalo derived components in beef food
  • Detection primers and method for yak, cattle and buffalo derived components in beef food

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0020] Example 1 Construction of the detection method for the three origin components of yak, cattle and buffalo in beef food:

[0021] 1. DNA extraction

[0022] Select conventional methods (such as CTAB method, SDS method and commercial kits, etc.) to extract the DNA in the beef food to be tested.

[0023] 2. Specific primer synthesis

[0024] Synthesize a pair of specific primers designed and developed by the present invention:

[0025] GTB-F:GAGGAGCCTGTTCTGTAATCG, its nucleotide sequence is shown in SEQ ID NO.1;

[0026] GTB-R: ATGGCCTAATTCAACTAAGCACTC, the nucleotide sequence of which is shown in SEQ ID NO.2;

[0027] 3. Quantitative PCR solution system preparation

[0028] Use the HRM master mix kit (such as Roche High Resolution Melting Mixkit from Roche) to prepare the QPCR solution, and the usage of each component is as follows in Table 1:

[0029] Table 1 QPCR solution system

[0030] name

Volume (μL)

HRM Mix

10

GTB-F

0.3

...

Embodiment 2

[0041] Embodiment 2 Sensitivity experiment

[0042] Low-limit detection test of yak, cattle and buffalo-derived DNA solutions: Dilute 10ng / ul yak, cattle and buffalo DNA solutions to 1ng / ul, 0.1ng / ul, 0.01ng / ul and 0.001ng / ul in sequence , and using the aforementioned detection technology for detection, it is finally confirmed that the present invention can effectively detect the DNA solution of yak, cattle or buffalo with a concentration of 0.01ng / ul.

[0043] Mass fraction detection lower limit sensitivity experiment: prepare 4 samples with yak meat mass fraction (yak meat mass / meat mass total mass) of 1%, 0.1%, 0.01% and 0.001% in the ground yak meat sample, record them with this patented technology Detection can effectively detect samples with a mass fraction of 1%, 0.1% and 0.01%, but cannot detect samples with a mass fraction of 0.001%, so the detection limit of the mass fraction of yak meat samples in the present invention is 0.01%. . According to the same method, the...

Embodiment 3

[0044] Embodiment 3 actual sample detection

[0045] 80 batches of samples were taken from 10 cities and prefectures including Chengdu, Aba Prefecture, and Deyang City in Sichuan Province, including 43 batches of yak jerky and 37 batches of beef jerky (collectively referred to as beef jerky). The QPCR solution system and amplification reaction conditions established in this experiment were used for HRM genotyping detection, and the relevant national standards were used for detection, and then the detection results of the two were compared. The detection results of this experimental method were completely consistent with the relevant national standard detection results. The accuracy rate is 100% (as shown in Table 1)

[0046] Table 1 Test results of 80 batches of dried meat in Sichuan Province

[0047]

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses detection primers and a method for yak, cattle and buffalo derived components in beef food. The primers comprise a primer GTB-F and a primer GTB-R, wherein the nucleotide sequence of the GTB-F is shown as SEQ ID NO.1; the nucleotide sequence of the GTB-R is shown as SEQ ID NO.2. The method comprises the following steps: carrying out quantitative PCR (Polymerase Chain Reaction) amplification on a to-be-detected sample by using the primers to obtain QPCR amplification data; carrying out HRM (High Resolution Melting) data analysis and detection on an amplification productby utilizing quantitative PCR instrument bundled software. According to the detection primers and the method disclosed by the invention, a HRM curve genotyping technology is applied to detection of three different bovine derived materials, so that reagent consumption cost of relevant detection is greatly reduced; meanwhile, detection time is shortened; detection accuracy can be improved, and a false positive result is avoided.

Description

technical field [0001] The invention belongs to the technical field of genetic engineering, and in particular relates to a primer and a method for detecting three origin components of yak, cattle and buffalo in beef food. Background technique [0002] Yak, cattle, and buffalo belong to different subspecies of the genus Bovis (or Buffalo), and their mitochondrial DNA similarity reaches 99%, with only a few bases different. For the detection of bovine-derived components in beef food, the existing technology uses the Taqman hydrolysis probe fluorescent quantitative PCR method, and there are three supporting import and export industry standards for detecting bovine-derived components, buffalo-derived components and Yak-derived ingredients. In this method, a pair of specific primers and Taqman probes are designed for the conserved mitochondrial DNA sequences of yak, cattle and buffalo. When detecting a sample, the primers and probes of the positive sample are amplified by PCR a...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12Q1/6888C12Q1/6851C12N15/11
CPCC12Q1/6851C12Q1/6888C12Q2531/113C12Q2527/107
Inventor 王立博陈小平鲁时旭陈勇张永辉邓莉周欣睿成晓情孙婉玲何晓梅常薇陆其聪何彪
Owner SICHUAN LIGHT INDUSTRY RESEARCH AND DESIGN INST
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com