Detection primers and method for yak, cattle and buffalo derived components in beef food
A detection method, the technology of yak, applied in the field of genetic engineering, can solve the problems of false positive detection results, long operation time, complicated operation, etc., and achieve the effect of improving accuracy, avoiding false positives, and good technical guarantee
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0020] Example 1 Construction of the detection method for the three origin components of yak, cattle and buffalo in beef food:
[0021] 1. DNA extraction
[0022] Select conventional methods (such as CTAB method, SDS method and commercial kits, etc.) to extract the DNA in the beef food to be tested.
[0023] 2. Specific primer synthesis
[0024] Synthesize a pair of specific primers designed and developed by the present invention:
[0025] GTB-F:GAGGAGCCTGTTCTGTAATCG, its nucleotide sequence is shown in SEQ ID NO.1;
[0026] GTB-R: ATGGCCTAATTCAACTAAGCACTC, the nucleotide sequence of which is shown in SEQ ID NO.2;
[0027] 3. Quantitative PCR solution system preparation
[0028] Use the HRM master mix kit (such as Roche High Resolution Melting Mixkit from Roche) to prepare the QPCR solution, and the usage of each component is as follows in Table 1:
[0029] Table 1 QPCR solution system
[0030] name
Volume (μL)
HRM Mix
10
GTB-F
0.3
...
Embodiment 2
[0041] Embodiment 2 Sensitivity experiment
[0042] Low-limit detection test of yak, cattle and buffalo-derived DNA solutions: Dilute 10ng / ul yak, cattle and buffalo DNA solutions to 1ng / ul, 0.1ng / ul, 0.01ng / ul and 0.001ng / ul in sequence , and using the aforementioned detection technology for detection, it is finally confirmed that the present invention can effectively detect the DNA solution of yak, cattle or buffalo with a concentration of 0.01ng / ul.
[0043] Mass fraction detection lower limit sensitivity experiment: prepare 4 samples with yak meat mass fraction (yak meat mass / meat mass total mass) of 1%, 0.1%, 0.01% and 0.001% in the ground yak meat sample, record them with this patented technology Detection can effectively detect samples with a mass fraction of 1%, 0.1% and 0.01%, but cannot detect samples with a mass fraction of 0.001%, so the detection limit of the mass fraction of yak meat samples in the present invention is 0.01%. . According to the same method, the...
Embodiment 3
[0044] Embodiment 3 actual sample detection
[0045] 80 batches of samples were taken from 10 cities and prefectures including Chengdu, Aba Prefecture, and Deyang City in Sichuan Province, including 43 batches of yak jerky and 37 batches of beef jerky (collectively referred to as beef jerky). The QPCR solution system and amplification reaction conditions established in this experiment were used for HRM genotyping detection, and the relevant national standards were used for detection, and then the detection results of the two were compared. The detection results of this experimental method were completely consistent with the relevant national standard detection results. The accuracy rate is 100% (as shown in Table 1)
[0046] Table 1 Test results of 80 batches of dried meat in Sichuan Province
[0047]
PUM

Abstract
Description
Claims
Application Information

- R&D
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com