Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Aspergillus fumigates SQH4, and applications thereof in preparation of taxifolin through biotransformation

A technology of Aspergillus fumigatus and microbial strains is applied in the field of biotransformation to prepare taxifolin, which can solve the problems of easily damaged parent nucleus structure, low product yield and the like, and achieves low production cost, high product yield and conversion rate. high effect

Active Publication Date: 2018-04-10
ZHEJIANG UNIV OF TECH +1
View PDF5 Cites 6 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Low product yield is a common problem in the preparation of natural products by acid hydrolysis. The structure of the mother nucleus is easily destroyed and other by-products are produced, resulting in low product yield.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Aspergillus fumigates SQH4, and applications thereof in preparation of taxifolin through biotransformation
  • Aspergillus fumigates SQH4, and applications thereof in preparation of taxifolin through biotransformation
  • Aspergillus fumigates SQH4, and applications thereof in preparation of taxifolin through biotransformation

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0029] Isolation and screening of embodiment 1 transformed strain

[0030] The Chinese medicinal material Smilax smilax was crushed through a 40-mesh sieve, 60 g of Smilax smilax powder was placed in a conical flask, and a small amount of sterile water was added to moisten it, and cultured at a constant temperature of 28° C. for 3 days. Then take out about 1g and make a suspension with 100mL sterile water, dilute 1×10 6 Spread on potato dextrose agar plate medium (PDA) after doubling, incubate at 28°C for 3 days, pick mold colonies with different colors and shapes and transfer them to fresh PDA plate medium, and culture at 28°C for 3 days to obtain spores Five abundant strains (see Table 1 for strain numbers) were stored in a refrigerator at 4°C for later use.

[0031] Pick 2 rings of spores from the plate culture medium of the above-mentioned strains with inoculation loops, inoculate them into 100mL initial fermentation medium (packed in a 250mL triangular bottle), shake and...

Embodiment 2

[0042] Embodiment 2: bacterial strain SQH4 transformation stability verification

[0043] The strain SQH4 was used as the transformed strain. After seed expansion cultivation, the fermentation liquid was prepared in a 100mL shake flask fermentation scale, and the fermentation liquid containing bacteria was used to transform astilbin to verify the transformation stability of the strain. The specific process steps are as follows:

[0044] (1) Inoculate the bacterial strain SQH4 slant bacterial classification preserved in 4 ℃ of refrigerators on fresh PDA plate culture medium, plate is cultivated at 28 ℃ of constant temperature 2d, and described PDA plate medium composition and preparation method are with embodiment 1;

[0045] (2) Use an inoculation loop to take the spores of the strain SQH4 after activation in step (1) into 50mL seed medium for 2 times, and culture them for 2 days at 28°C and 200r / min constant temperature shaking conditions to obtain a dry cell concentration of ...

Embodiment 3

[0049] Embodiment 3: the taxonomic identification of bacterial strain SQH4

[0050] The SQH4 strain was inoculated on the PDA plate medium, and cultured at 28°C for 2 days, and colonies would grow. The colony is white and fluffy at the beginning, and then turns gray-green; it produces a large number of powdery conidia, the conidia ears are cylindrical, and are in different shades of green, and the conidia are spherical, rough, and green.

[0051] The strain SQH4 was submitted to Sangon Bioengineering (Shanghai) Co., Ltd. for rDNA ITS sequencing, and the sequence size was 574bp. The specific sequence (shown in SEQ ID NO: 1) is as follows:

[0052] 5'-CCTGCGGAAGGATCATTACCGAGTGAGGGCCCTCTGGGTCCAACCTCCCACCCGTGTCTATCGTACCTTGTTGCTTCGGCGGGCCCGCCGTTTCGACGGCCGCCGGGGAGGCCTTGCGCCCCCGGGCCCGCGCCCGCCGAAGACCCCAACATGAACGCTGTTCTGAAAGTATGCAGTCTGAGTTGATTATCGTAATCAGTTAAAACTTTCAACAACGGATCTCTTGGTTCCGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAGTCTTTGAACGCACATTGCGCCCCCTGGTATTCCG...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses aspergillus fumigates SQH4, and applications thereof in preparation of taxifolin through biotransformation. According to the applications, astilbin is taken as a substrate, a fermentation broth prepared via aspergillus fumigates SQH4 fermentation is taken as a catalyst, and the taxifolin conversion rate is 92.3% when the substrate feed concentration is controlled to be 3g / L. The technical advantages are that: the shortage problem of taxifolin extracted from plants is solved; the conversion specificity is better and product yield is higher than that of astilbin acid hydrolysis method. A production of taxifolin disclosed in the invention is low in production cost and environment pollution, and high in conversion rate.

Description

(1) Technical field [0001] The invention belongs to the technical field of biochemical engineering, and in particular relates to a method for preparing taxifolin by using astilbin as a raw material through a biotransformation method. (2) Background technology [0002] Taxifolin, also known as dihydroquercetin, taxifolin, taxifolin, belongs to a kind of dihydroflavonol compounds, the chemical name is 3,5,7,3',4 '-pentahydroxyflavanone (3,5,7,3',4'-pentahydroxyflavanone), CAS No. 480-18-2, molecular formula C 15 h 12 o 7 , the molecular weight is 304.25, the structural formula is shown in figure 1 . [0003] Studies in recent years have shown that taxifolin has a variety of pharmacological activities, such as very strong antioxidant activity; lowering blood lipids, blood viscosity, blood pressure and blood sugar, protecting red blood cells from hemolysis caused by oxidation, and can be used for the treatment of cardiovascular diseases and diabetes Treatment; it has a prot...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N1/14C12P17/06C12R1/68
CPCC12N1/14C12P17/06C12N1/145C12R2001/68
Inventor 梅建凤陈翔应国清沈琪华易喻陈才军李彬
Owner ZHEJIANG UNIV OF TECH
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com