Unlock instant, AI-driven research and patent intelligence for your innovation.

Method of utilizing yarrowia lipolytica strain having reductive TCA path to aerobically synthesize succinic acid

A technology of Yarrowia lipolytica and Yarrowia lipolytica, which is applied in the field of metabolic engineering and microbial fermentation, can solve the problems of low theoretical yield, reduce production costs, have good tolerance to acidic conditions, and eliminate by-product ammonium sulfate the effect of

Active Publication Date: 2018-04-17
盛虹控股集团有限公司
View PDF4 Cites 5 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0019] Aiming at the defect of low theoretical yield in the process of producing succinic acid by Yarrowia lipolytica aerobic fermentation, the present invention provides a method for aerobically synthesizing succinic acid by Yarrowia lipolytica strain with reducing TCA pathway

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Method of utilizing yarrowia lipolytica strain having reductive TCA path to aerobically synthesize succinic acid
  • Method of utilizing yarrowia lipolytica strain having reductive TCA path to aerobically synthesize succinic acid
  • Method of utilizing yarrowia lipolytica strain having reductive TCA path to aerobically synthesize succinic acid

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0042] The construction of embodiment 1 engineering strain

[0043] (1) Overexpression of Tbfrd gene

[0044] Strain: Yarrowia lipolytica PGC91 (Po1f Δsdh5 Δach1 Ylpyc)

[0045] a. Construction of expression vector

[0046] According to the Tbfrd gene sequence (KT026107.1) published by Genbank, it was synthesized by General Biosystems (Anhui) Co., Ltd. after codon optimization. And at the same time design primers according to the expression plasmid pKi-1 sequence:

[0047] Tbfrd-F:

[0048] ATAAGAATCATTCAAAGGTTATGGTGGACGGTCGATCTTC

[0049] Tbfrd-R:

[0050] ACATAACTAATTACATGATTTTAGGAGCCAGAGGGCTCGG

[0051] Using the Tbfrd gene sequence synthesized by codon optimization as a template, PCR (polymerase chain reaction) amplification using Tbfrd-F / Tbfrd-R primers was used to obtain assembled fragments carrying corresponding terminal homologous sequences. PCR reaction conditions: pre-denaturation at 97°C for 5min, denaturation at 94°C for 60s, annealing at 56°C for 30s, exten...

Embodiment 2

[0114] The comparison of different strains of embodiment 2 producing succinic acid efficiency

[0115] Engineering strains: Yarrowia lipolytica (Yarrowia lipolytica) PGC91, PGC91 TbFRD and PGC91TbFRD-EcFUM.

[0116] Yarrowia lipolytica PGC91, PGC91 TbFRD and PGC91 TbFRD-EcFUM stored in frozen glycerol tubes were streaked and inoculated on YPG plates (2% peptone, 1% yeast powder, 2% glycerol, 2% agar powder), and cultured at 30°C for 30h.

[0117] The single colony grown on the above plate was inserted into a 250ml Erlenmeyer flask equipped with 50ml of YPD liquid medium (2% peptone, 1% yeast powder, 2% glucose), and activated by shaking at 220rpm at 30°C.

[0118] Seed culture: 1ml of activated culture solution was transferred to a 250ml Erlenmeyer flask filled with 50ml of fermentation medium (2% peptone, 1% yeast powder, 4% glucose) and cultivated aerobically at 220rpm for 24h at 30°C.

[0119]Fermentation culture: Get 2ml of activated culture fluid and transfer to 250ml Er...

Embodiment 3

[0124] The synthesis of succinic acid of the PGC91 TbFRD-EcFUM strain when glycerol was used as the only carbon source in Example 3

[0125] Engineering strains: Yarrowia lipolytica (Yarrowia lipolytica) PGC91, PGC91 TbFRD and PGC91TbFRD-EcFUM.

[0126] Yarrowia lipolytica PGC91, PGC91 TbFRD and PGC91 TbFRD-EcFUM stored in frozen glycerol tubes were streaked and inoculated on YPG plates (2% peptone, 1% yeast powder, 2% glucose, 2% agar powder), and cultured at 30°C for 30h.

[0127] Insert the single colony grown on the above plate into a 250ml Erlenmeyer flask equipped with 50ml of YPG liquid medium (2% peptone, 1% yeast powder, 2% glucose), and activate it at 30° C. with shaking at 220 rpm. Seed culture: transfer 1ml of activated culture solution to a 250ml Erlenmeyer flask filled with 50ml of fermentation medium (2% peptone, 1% yeast powder, 4% glucose), and cultivate aerobically at 220rpm for 24h at 30°C

[0128] Fermentation culture: get 2ml of activated culture fluid an...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a method of utilizing a yarrowia lipolytica strain having a reductive TCA path to aerobically synthesize succinic acid. The yarrowia lipolytica engineering strain heterogeneously expresses key enzymes: fumaric reductase (FRD) and fumarase (FUM) in the reductive TCA path, and theoretical yield is substantially increased when compared with that of conventional oxidative TCA paths. The process of electrodialysis or acidizing ultrafiltration is omitted in a step of separating and purifying succinic acid, and no ammonium sulfate which is a byproduct is generated, so that themethod has considerable application value and prospect.

Description

technical field [0001] The invention relates to a method for aerobically synthesizing succinic acid by using a Yarrowia lipolytica strain with a reducing TCA pathway, and belongs to the fields of metabolic engineering and microbial fermentation. Background technique [0002] Succinic acid, also known as succinic acid, is widely used in detergents, surfactants, food additives, antibacterial agents and pharmaceutical industries, and is selected as the first of the twelve most commercially valuable platform compounds by the U.S. Department of Energy (Werpy and Pedersen, US Department of Energy. 2005). Succinic acid produced by microbial fermentation using renewable resources as raw materials gets rid of the dependence on petrochemical raw materials and is a green platform product. [0003] The microbial synthesis of succinic acid mainly depends on various bacteria, such as Actinobacillus succinogenes and Escherichia coli. These microorganisms can efficiently produce succinic ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N15/81C12N15/53C12N15/60C12P7/46C12R1/645
CPCC12N9/001C12N9/88C12N15/815C12P7/46C12Y103/01006C12Y402/01002
Inventor 祁庆生梁泉峰崔志勇
Owner 盛虹控股集团有限公司
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More