A novel method for detecting biological activity of T cell immunomodulator
A technology of cellular immunity and biological activity, applied in the field of biomedicine, can solve the problems of long time required, high cost and large variability, and achieve the effects of simple operation, high positive rate and stable cell generation.
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0055] Example 1: Construction of Sleeping Beauty transposon dual-plasmid system
[0056] 1. Construction of pGL4.15-IL-2P reporter gene vector and construction of pGL4.15-NFAT reporter gene vector
[0057] (1) Whole gene synthesis IL-2 promoter (-329 to +48 position), wherein upstream has KpnI restriction site GGTACC, downstream band HindIII restriction site AAGCTT, IL-2 promoter (-329 to + 48 bits) The full sequence is as follows:
[0058] GGTACCGAAAATTTTCTGAGTTACTTTTGTATCCCCACCCCCTTAAAGAAAGGAGGAAAAACTGTTTCATACAGAA GGCGTTAATTGCATGAATTAGAGCTATCACCTAAGTGTGGGCTAATGTAACAAAGAGGGATTTCACCTACATCCATTCAG TCAGTCTTTGGGGGTTTAAAGAATTCCAAAGAGTCATCAGAAGAGGAAAAATGAAGGTAATGTTTTTTCAGACAGGTAAA GTCTTTGAAAATATGTGTAATATGTAAAACATTTTGACACCCCCATAATATTTTTCCAGAATTAACAGTATAAATTGCAT CTCTTGTTCAAGAGTTCCCTATCACTCTCTTTAATCACTACTCACAGTAACCTCAACTCCTGCCACAAAGCTT。
[0059] The whole gene synthesis product and the pGL4.15 plasmid were digested with KpnI and HindIII, and the IL-2 promoter was inserted into the pG...
Embodiment 2
[0074] Example 2: IL-2 promoter drives the acquisition of luciferase stable cell lines and NFAT RE-driven luciferase stable cell lines
[0075] 1. Sleeping Beauty transposon system integrated reporter gene into Jurkat host cells
[0076] (1) Sleeping Beauty double-plasmid system transfection host cells
[0077] (1) Subculture Jurkat cells 1 day in advance;
[0078] (2) Add RPMI1640 growth medium + 10% bovine serum + 1% double antibody to two wells of a 6-well plate, 2ml / well, preheat in the incubator; take another 220μl Cell line Nucleofector Solution V in the incubator Preheat for 10 minutes;
[0079] (3) Take 5 μg of pGL4.15-IL-2P plasmid and 5 μg of pGL4.15-NFAT plasmid respectively in two EP tubes, and then add 0.5 μg of pcDNA3.1-SB11 plasmid to mix for later use;
[0080] (4) Turn on the Nucleofector electrotransfer instrument and select program X-001;
[0081] (5) Jurkat cell counting, 1 million cells were divided into two centrifuge tubes, centrifuged at 90g for 5mi...
Embodiment 3
[0105] Embodiment 3: the test of biological activity of T cell activator
[0106] 1. Test of biological activity of CTLA4-Fc fusion protein
[0107] The IL-2P Luc-positive cell line positively correlated with IL2 and luciferase activity obtained through screening was selected as clone No. 6 for subsequent experiments. According to the cell density of 100,000 cells / well, the initial concentration of CTLA4-Fc was 67 μg / ml, and 10-fold serial dilution was performed in 13 gradients, with a total of 14 concentration points. CTLA4-Fc was used for 6 hours to detect luciferase activity.
[0108] Such as Figure 6 As shown, after adding serially diluted CTLA4-Fc fusion protein, as the concentration of CTLA4-Fc increases, the fluorescence intensity gradually decreases, that is, the expression of IL-2 gradually decreases. It can be seen that with the increase of CTLA4-Fc concentration, The enhanced activity of inhibiting T cell activation indicates that the system can be used to quant...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More 


