Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

A kind of sarna and its use

A use, PD-L1 technology, applied in the field of tumor molecular biology, to enhance the immune response and improve the effect of treatment

Active Publication Date: 2021-08-13
张灏
View PDF2 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

For drugs targeting these new pathways, there is still a lot of basic research and clinical trials to be done, so it will take a long time

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • A kind of sarna and its use
  • A kind of sarna and its use
  • A kind of sarna and its use

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0026] The design of embodiment 1saRNA molecule and its influence on PTPRO expression

[0027] 1. Design of saRNA

[0028] The sequence of the PTPRO promoter region was obtained at the website NCBI (http: / / www.ncbi.nlm.nih.gov / ).

[0029] According to the design principle of RNA sequence, 5 pairs of double-stranded small RNA activation sequences of PTPRO were designed and obtained, and the 5 pairs of sequences corresponded to the PTPRO promoter site. The sequence (SEQ ID NO: 1) of the PTPRO promoter region from the -3000 site to the -1 site is as follows:

[0030]TGATTTGGAGTCTTGAAAATAGCATAATAAGATTTATCATACTTTGGAAGTATTGTATTGAAAAACCAGTCAATAGCTCAAAGAAACACAAAACATGCTCTATGAATTGAAAACCCCACACTGTGGATGACACAGCATTCACATTCTTTATGAGAATCTCTTCTAGGACACTGTTATGGTTTAAGTGCAATAAAAACAAATGAAAGTATTTTATCCAGCAATAGCAATGTAAAATACTTTTCTCTAGAGAGGAAATTTTCTGTGATTATAAAATAATACTTTCAGTCTTCAGCCCATCTAACCACAATGTTACTAATAAAATAACAACAATGCCAATTACTAATGCTTTACTACTTACTGTTTACTGTTATTGTTCCTCCAAAGTGGTCCACATAATATATATATATATATATATATATA...

Embodiment 2

[0056] Example 2 westen blot experiment verifies that SaPTPRO reduces the phosphorylation level of PD-L1 protein

[0057] The cells in the logarithmic growth phase were seeded on a 6-well plate, and the cell incubator continued to cultivate, and the saRNA was transfected when the cell abundance was 50%-60°. Transfection was carried out according to the instructions of lipofectamine2000 transfection, and the transfection concentration was 50nmol / L. After 48 hours, the protein was extracted, the protein concentration was measured by BAC method, and the expression level of PTPROp-PD-L1PD-L1 protein was detected by western blot.

[0058] SDS-PAGE electrophoresis: Take a certain amount of protein extract (containing 5 μg of protein) and co-immunoprecipitation products, add appropriate 5×SDS loading buffer, boil in a boiling water bath for 10 minutes to denature the protein, and centrifuge at 10,000×g for 10 minutes; SDS-PAGE The electrophoresis separation gel is 10%, and the stack...

Embodiment 3

[0065] Example 3 MTT detection of the effects of three groups of treatments on the growth of TE1 cells and ELISA detection of immunosuppressive factors IL-10, TGF-β and immune activation factors IL-12 and IL-23 in the co-culture supernatants of three groups of tumor cells and T cells content

[0066] Step 1: Preparation of mature DC cells

[0067] Density gradient centrifugation for separation of PBMCs:

[0068] (1) Take 10m1 heparin anticoagulated peripheral venous blood from healthy volunteers under sterile conditions.

[0069] (2) Thoroughly mix the venous blood with an equal volume of sterile saline, and slowly drip it into the surface of the Ficoll-Paque human lymphocyte separation solution along the tube wall with a 5ml syringe. Centrifuge at 2000rpm for 20min.

[0070] (3) After centrifugation, the liquid in the tube is divided into four layers: the upper layer is a yellow plasma layer, the second layer is a white cloud-like narrow band, the third layer is a lymphocy...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a saRNA, which includes a nucleotide sequence complementary to the -3000 to -200 site region of the PTPRO gene promoter region; the invention also discloses that the saRNA is used in the preparation of a drug for treating tumors use in . The SaRNA targeting the PTPRO gene of the present invention can reduce the phosphorylation level of the Tyr123 site of PD‑L1, block the PD‑1 / PD‑L1 pathway, inhibit the growth of tumor cells, and restore the activity of T cells; at the same time, the SaRNA of the present invention saRNA and PD-L1 inhibitors play a synergistic effect in the treatment of tumors, significantly improving the therapeutic effect of PD-L1 inhibitors. Therefore, the saRNA of the present invention can be used to prepare antitumor drugs.

Description

technical field [0001] The invention relates to the technical field of tumor molecular biology, in particular to tumor immunotherapy technology, especially a saRNA for effectively treating tumors. Background technique [0002] Tumor cell therapy is to mobilize the body's immune system and enhance anti-tumor immunity, thereby inhibiting and killing tumor cells. Tumor cell therapy is one of the most promising research directions in the field of tumor therapy. PD-1 (programmed death-1) is obtained from the apoptotic T cell hybridoma. It is named as programmed death-1 receptor because it is related to apoptosis. PD-1 programmed death receptor is a An important immunosuppressive molecule, a member of the CD28 superfamily. PD-1 is mainly expressed in activated T cells and B cells, and is a surface receptor of activated T cells. PD-1 has two ligands, namely PD-L1 [0003] (B7-H1) and PD-L2 (B7-DC). The tumor microenvironment in the body will induce infiltrating T cells to highl...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Patents(China)
IPC IPC(8): C12N15/113A61K48/00A61K31/713A61K45/06A61P35/00
CPCA61K31/713A61K45/06C12N15/113C12N2310/113A61K2300/00
Inventor 张灏
Owner 张灏
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com