A kind of sarna and its use
A use, PD-L1 technology, applied in the field of tumor molecular biology, to enhance the immune response and improve the effect of treatment
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0026] The design of embodiment 1saRNA molecule and its influence on PTPRO expression
[0027] 1. Design of saRNA
[0028] The sequence of the PTPRO promoter region was obtained at the website NCBI (http: / / www.ncbi.nlm.nih.gov / ).
[0029] According to the design principle of RNA sequence, 5 pairs of double-stranded small RNA activation sequences of PTPRO were designed and obtained, and the 5 pairs of sequences corresponded to the PTPRO promoter site. The sequence (SEQ ID NO: 1) of the PTPRO promoter region from the -3000 site to the -1 site is as follows:
[0030]TGATTTGGAGTCTTGAAAATAGCATAATAAGATTTATCATACTTTGGAAGTATTGTATTGAAAAACCAGTCAATAGCTCAAAGAAACACAAAACATGCTCTATGAATTGAAAACCCCACACTGTGGATGACACAGCATTCACATTCTTTATGAGAATCTCTTCTAGGACACTGTTATGGTTTAAGTGCAATAAAAACAAATGAAAGTATTTTATCCAGCAATAGCAATGTAAAATACTTTTCTCTAGAGAGGAAATTTTCTGTGATTATAAAATAATACTTTCAGTCTTCAGCCCATCTAACCACAATGTTACTAATAAAATAACAACAATGCCAATTACTAATGCTTTACTACTTACTGTTTACTGTTATTGTTCCTCCAAAGTGGTCCACATAATATATATATATATATATATATATA...
Embodiment 2
[0056] Example 2 westen blot experiment verifies that SaPTPRO reduces the phosphorylation level of PD-L1 protein
[0057] The cells in the logarithmic growth phase were seeded on a 6-well plate, and the cell incubator continued to cultivate, and the saRNA was transfected when the cell abundance was 50%-60°. Transfection was carried out according to the instructions of lipofectamine2000 transfection, and the transfection concentration was 50nmol / L. After 48 hours, the protein was extracted, the protein concentration was measured by BAC method, and the expression level of PTPROp-PD-L1PD-L1 protein was detected by western blot.
[0058] SDS-PAGE electrophoresis: Take a certain amount of protein extract (containing 5 μg of protein) and co-immunoprecipitation products, add appropriate 5×SDS loading buffer, boil in a boiling water bath for 10 minutes to denature the protein, and centrifuge at 10,000×g for 10 minutes; SDS-PAGE The electrophoresis separation gel is 10%, and the stack...
Embodiment 3
[0065] Example 3 MTT detection of the effects of three groups of treatments on the growth of TE1 cells and ELISA detection of immunosuppressive factors IL-10, TGF-β and immune activation factors IL-12 and IL-23 in the co-culture supernatants of three groups of tumor cells and T cells content
[0066] Step 1: Preparation of mature DC cells
[0067] Density gradient centrifugation for separation of PBMCs:
[0068] (1) Take 10m1 heparin anticoagulated peripheral venous blood from healthy volunteers under sterile conditions.
[0069] (2) Thoroughly mix the venous blood with an equal volume of sterile saline, and slowly drip it into the surface of the Ficoll-Paque human lymphocyte separation solution along the tube wall with a 5ml syringe. Centrifuge at 2000rpm for 20min.
[0070] (3) After centrifugation, the liquid in the tube is divided into four layers: the upper layer is a yellow plasma layer, the second layer is a white cloud-like narrow band, the third layer is a lymphocy...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More 


