Unlock instant, AI-driven research and patent intelligence for your innovation.

MDCK cell line with IFN-β1 coding gene deletion and its construction method and application

A technology for encoding genes and construction methods, which is applied in the field of biotechnology and veterinary biological product engineering, can solve the problems of not finding the proliferation efficiency of interferon β1, and achieve the effect of improving the proliferation efficiency

Active Publication Date: 2021-08-03
JIANGSU ACAD OF AGRI SCI
View PDF0 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0006] At present, there is no literature report on the relationship between interferon β1 and the improvement of the proliferation efficiency of avian influenza virus in MDCK cells

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • MDCK cell line with IFN-β1 coding gene deletion and its construction method and application
  • MDCK cell line with IFN-β1 coding gene deletion and its construction method and application
  • MDCK cell line with IFN-β1 coding gene deletion and its construction method and application

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0024] Example 1 Construction of gRNA expression vector

[0025] 1. Design DNA oligo primers

[0026] Analyze the gene sequence of canine IFN-β1 (GeneID: 481558), according to the "N(N...NN) 18 NNGG" (N stands for any deoxyribonucleotide) sequence gene fragments, and considering the specificity of the sequence and the possible editing off-target efficiency, select GCTCATGGCAAGAGCCATGGTGG as the target sequence 1, and GATAATCTGTAAGTATATTAAGG as the target sequence 2. For these two Target sequence, design two pairs of DNA oligo primers for the construction of gRNA expression vector, the sequence is as follows:

[0027] Target sequence 1F: CACCGGCTCATGGCAAGAGCCATGG

[0028] Target sequence 1R: AAACGCCATGGCTCTTGCCATGAGC

[0029] Target sequence 2F: CACCGGATAATCTGTAAGTATATTA

[0030] Target sequence 2R: AAACGTAATATACTTACAGATTATC

[0031] 2. Construction of gRNA expression vector

[0032] Two pairs of target sequence primers are annealed separately to generate two DNA double s...

Embodiment 2

[0033] Example 2 Construction of pCas9-IRES-GFP

[0034] 1. Synthesis of Cas9 protein-encoding DNA sequence suitable for genome editing in MDCK cells

[0035] According to the protein translation codon preference of dogs, the Cas9 protein translation codon was optimized, and at the same time, one NLS sequence of SV40 virus was added to both ends of the ORF of the Cas9 gene to ensure that both the N-terminal and C-terminal of the Cas9 protein contained SV40 after expression The NLS sequence. The nucleic acid coding sequence of Cas9 is shown in SEQ ID NO.3. This sequence was chemically synthesized and used for vector construction.

[0036] 2. Construction of pCas9-IRES-GFP

[0037] The nucleic acid coding sequence of Cas9 and the expression vector pCMV-MCS-IRES-GFP were digested with NheI and XhoI (purchased from TAKARA Biotechnology Company), and the final expression of Cas9 was obtained by T4 DNA ligase (purchased from TAKARA Biotechnology Company). The expression vector p...

Embodiment 3

[0038] Example 3 Suspension transfection and screening and determination of MDCK-Sus-KO-IFN-β1 cell line

[0039] 1. Cationic polymer-mediated suspension cell transfection

[0040] Seed the initial cell density at 1×10 6 cells / ml MDCK-Sus cell line (domesticated and amplified by the National Veterinary Biological Products Engineering Technology Research Center of Jiangsu Academy of Agricultural Sciences, this cell line can be cultured in single-cell suspension. For specific methods, please refer to: Feng Lei, Wu Peipei, Chu Xuan, Wang Weifeng, Chen Li, Hou Jibo, MDCK single-cell suspension growth domestication screening and its preliminary application in AIV value-added, Zhejiang Agricultural Journal, 2015, 27 (6): 913-920.) in 50ml TPP culture tube, suspension After culturing overnight, it was used for plasmid transfection. Before transfection, the medium was replaced with Opti-MEM medium (purchased from Invitrogen) and incubated for 10 minutes. Take 10ml of cell suspensio...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to an MDCK cell line with IFN-β1 coding gene deletion and its construction method and application, and belongs to the technical field of biotechnology and veterinary biological product engineering. The cell line named MDCK‑Sus‑KO‑IFN‑β1 was deposited on November 22, 2016 in the General Microbiology Center (CGMCC) of the China Committee for the Collection of Microbial Cultures (abbreviated as CGMCC), the preservation number is CGMCC NO.13288, and the preservation address Institute of Microbiology, Chinese Academy of Sciences, No. 3, Courtyard No. 1, Beichen West Road, Chaoyang District, Beijing. The present invention can significantly improve the proliferation efficiency of avian influenza virus in MDCK cells by knocking out the IFN-β1 coding gene in MDCK cells, thereby removing the natural immune signal molecules of cells. The cell strain can be used for avian influenza virus proliferation cell cloning.

Description

technical field [0001] The invention relates to an MDCK cell line with IFN-β1 coding gene deletion and its construction method and application, and belongs to the technical field of biotechnology and veterinary biological product engineering. Background technique [0002] Canine kidney (MDCK) cells are currently the main host cells used for the propagation of avian influenza virus. Major research institutes and veterinary vaccine manufacturers are conducting research on seed cell selection, cell suspension culture, and virus propagation technology for the cell-proliferated avian influenza virus. [0003] In the study, we found that when the avian influenza virus was continuously passaged in MDCK cells, its proliferation efficiency showed a gradually decreasing trend. Even when the continuous multiplication reaches a certain generation, the multiplication efficiency of the avian influenza virus will drop off like a cliff. The reason for this happening is not yet clear. How...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Patents(China)
IPC IPC(8): C12N5/071C12N7/00C12R1/93
CPCC07K14/565C12N7/00C12N15/63C12N2760/16151
Inventor 冯磊恽君雯吴培培陈丽侯继波
Owner JIANGSU ACAD OF AGRI SCI