MDCK cell line with IFN-β1 coding gene deletion and its construction method and application
A technology for encoding genes and construction methods, which is applied in the field of biotechnology and veterinary biological product engineering, can solve the problems of not finding the proliferation efficiency of interferon β1, and achieve the effect of improving the proliferation efficiency
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0024] Example 1 Construction of gRNA expression vector
[0025] 1. Design DNA oligo primers
[0026] Analyze the gene sequence of canine IFN-β1 (GeneID: 481558), according to the "N(N...NN) 18 NNGG" (N stands for any deoxyribonucleotide) sequence gene fragments, and considering the specificity of the sequence and the possible editing off-target efficiency, select GCTCATGGCAAGAGCCATGGTGG as the target sequence 1, and GATAATCTGTAAGTATATTAAGG as the target sequence 2. For these two Target sequence, design two pairs of DNA oligo primers for the construction of gRNA expression vector, the sequence is as follows:
[0027] Target sequence 1F: CACCGGCTCATGGCAAGAGCCATGG
[0028] Target sequence 1R: AAACGCCATGGCTCTTGCCATGAGC
[0029] Target sequence 2F: CACCGGATAATCTGTAAGTATATTA
[0030] Target sequence 2R: AAACGTAATATACTTACAGATTATC
[0031] 2. Construction of gRNA expression vector
[0032] Two pairs of target sequence primers are annealed separately to generate two DNA double s...
Embodiment 2
[0033] Example 2 Construction of pCas9-IRES-GFP
[0034] 1. Synthesis of Cas9 protein-encoding DNA sequence suitable for genome editing in MDCK cells
[0035] According to the protein translation codon preference of dogs, the Cas9 protein translation codon was optimized, and at the same time, one NLS sequence of SV40 virus was added to both ends of the ORF of the Cas9 gene to ensure that both the N-terminal and C-terminal of the Cas9 protein contained SV40 after expression The NLS sequence. The nucleic acid coding sequence of Cas9 is shown in SEQ ID NO.3. This sequence was chemically synthesized and used for vector construction.
[0036] 2. Construction of pCas9-IRES-GFP
[0037] The nucleic acid coding sequence of Cas9 and the expression vector pCMV-MCS-IRES-GFP were digested with NheI and XhoI (purchased from TAKARA Biotechnology Company), and the final expression of Cas9 was obtained by T4 DNA ligase (purchased from TAKARA Biotechnology Company). The expression vector p...
Embodiment 3
[0038] Example 3 Suspension transfection and screening and determination of MDCK-Sus-KO-IFN-β1 cell line
[0039] 1. Cationic polymer-mediated suspension cell transfection
[0040] Seed the initial cell density at 1×10 6 cells / ml MDCK-Sus cell line (domesticated and amplified by the National Veterinary Biological Products Engineering Technology Research Center of Jiangsu Academy of Agricultural Sciences, this cell line can be cultured in single-cell suspension. For specific methods, please refer to: Feng Lei, Wu Peipei, Chu Xuan, Wang Weifeng, Chen Li, Hou Jibo, MDCK single-cell suspension growth domestication screening and its preliminary application in AIV value-added, Zhejiang Agricultural Journal, 2015, 27 (6): 913-920.) in 50ml TPP culture tube, suspension After culturing overnight, it was used for plasmid transfection. Before transfection, the medium was replaced with Opti-MEM medium (purchased from Invitrogen) and incubated for 10 minutes. Take 10ml of cell suspensio...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More 


