Klebsiella strain and application thereof in river sewage and rural ammonia-containing domestic sewage
A technology of Klebsiella and strains, applied in the application field of denitrification, which can solve the problems of many reaction steps, long process flow, and low cell concentration in the denitrification process, and achieve low dissolved oxygen concentration and simple denitrification process , the effect of high cell yield
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0035] Isolation, Screening and Characterization of Heterotrophic Nitrification-Aerobic Denitrification Strains
[0036] 1. Enrichment culture: Take 10g of Yuhang Xingqiao river sludge sample in a conical flask filled with 100ml of sterile normal saline, oscillate until the sample is completely dispersed and fully mix with sterile normal saline to prepare a bacterial suspension. Take 10ml of the bacterial suspension and transfer it to 100ml of acclimatization medium, and shake and culture at 30°C and 200r / min for 2 days. This is the first acclimatization cycle. Take 10ml of the previous culture and transfer it to the second-stage acclimatization medium, and culture it with shaking at 30°C and 200r / min for 2 days.
[0037] 2. Initial screening of bacterial strains: Take 10ml of the above-mentioned bacterial solution that has been domesticated and cultivated for 24 hours, add it to a conical flask containing 90ml of sterile normal saline, and dilute the sample to 10ml according to...
Embodiment 2
[0045] Example two denitrification bacterial strain molecular biology identification
[0046] Genomic DNA of SD3 was extracted using the Microbial Genome Extraction Kit of Hangzhou Baosai Biological Co., Ltd., and the 16S rDNA fragment was amplified using this as a template. The identified primers were 27f:AGAGTTTGATCCTGGCTCAG and 1492R:GGTTACCTTGTTACGACTT. PCR reaction system (50uL): Template DNA 1uL, 2xPCR superpfu mix 25uL, 27f and 1492R primers 1uL each, add sterile deionized water until the reaction system is 50uL. PCR program: 94°C for 5min, [94°C for 30s, 55°C for 30s, 72°C for 1min and 30s] x30 cycle, 72°C for 5min, 4°C for 5min. The recovered product after PCR purification was sent to a gene sequencing company for sequencing. The obtained 16S rDNA sequence of the SD3 strain is shown in SEQ ID NO.1. According to the homologous sequence comparison analysis of NCBI database, the SD3 strain has the closest genetic relationship with Klebsiella sp, with 100% homology, an...
Embodiment 3
[0048] Klebsiella sp. KSND-3 batch culture to investigate the ammonia oxidation rate of ammonia oxidizing bacteria at different initial concentrations. The experiment was carried out in a 250ml Erlenmeyer flask with initial pH=7.8, 30°C, 150r / min, adding culture solution and bacteria solution, and the whole reaction volume was 100ml. The concentration of NH4-N is successively set to 0mg / l, 10mg / l, 20mg / l, 50mg / l, 100mg / l, 200mg / l, 500mg / l, 1000mg / l. In order to prevent the influence of acidity produced by ammonia oxidation on bacterial activity, the culture solution contained 50mmol / L phosphate buffer. The ammonia oxidation ability of the bacterial strain was judged by measuring the removal rate of ammonia nitrogen, and the results were as follows: figure 2 As shown, if the initial concentration of ammonia nitrogen is below 100mg / L, the removal efficiency of ammonia nitrogen within 24 hours is as high as 90%; even if the initial concentration of ammonia nitrogen is as high a...
PUM

Abstract
Description
Claims
Application Information

- Generate Ideas
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com