Gene fine mapping method adopting map-based cloning principle and based on plant genome sequencing and inter-subspecies hybrid segregation populations

A plant genome and whole genome sequencing technology, applied in the fields of genomics, biochemical equipment and methods, and microbial determination/inspection, etc., can solve the problems of inability to carry out genetic work, time-consuming verification, and expansion of human and material costs, etc. To achieve the effect of saving manpower, accurate and reliable statistical analysis results, and accurate and reliable results

Inactive Publication Date: 2018-08-24
INST OF GENETICS & DEVELOPMENTAL BIOLOGY CHINESE ACAD OF SCI
View PDF4 Cites 5 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Among them, the map-based cloning method takes a lot of time to verify the polymorphic molecular markers between the hybrid parents, and even when the chromosome walk is gradually approaching the target gene or the available polymorphic markers cannot be obtained when the chromosome is registered, the genetic work cannot be carried out. On the other hand, in the fine-mapping step of the gene, more mutant phenotype plants in the isolated population are needed to screen recombinants, which increases the cost of manpower and material resources

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Gene fine mapping method adopting map-based cloning principle and based on plant genome sequencing and inter-subspecies hybrid segregation populations
  • Gene fine mapping method adopting map-based cloning principle and based on plant genome sequencing and inter-subspecies hybrid segregation populations
  • Gene fine mapping method adopting map-based cloning principle and based on plant genome sequencing and inter-subspecies hybrid segregation populations

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0039] Example 1. Obtaining phenotypic mutant strains by mutagenesis and preparing offspring populations of mutant strains and wild strains

[0040] 1. Obtaining phenotypic mutant strains by mutagenesis

[0041] 1. Using rice kittake seeds as raw materials, carry out EMS mutagenesis (take the seeds, first soak them in clear water for 16 hours, and then soak them in 0.5% EMS solution for 8 hours).

[0042] 2, the seed that step 1 obtains is sowed and cultivated into a plant, and the plant harvests the seed after selfing (M 1 substitute seeds).

[0043] 3, the seeds that step 2 is obtained are sown and cultivated as plants, harvest seeds after plant selfing (M 2 substitute seeds).

[0044] 4. The seeds obtained in step 3 were sown and grown into plants, and a mutant with a single tiller phenotype was screened out, and named mutant Mu1.

[0045] Two months after transplanting, the phenotype photos of rice kittake and mutant Mu1 are shown in figure 1 .

[0046] 2. Preparatio...

Embodiment 2

[0053] Embodiment 2, map position cloning gene location

[0054] 1. The F obtained from Example 1 2 In the generation segregation population, the leaves of 50 plants with single tiller phenotype were randomly selected, and the leaves were mixed with equal mass to extract genomic DNA to obtain a single tiller DNA pool.

[0055] 2. Preliminary positioning

[0056] The single tiller DNA pool constructed in step 1 was amplified by PCR using 180 pairs of SSR markers, and a molecular marker S2 closely linked to the single tiller phenotype was screened.

[0057] S2-F (5'-3'): TATAAGGAAAAGAACGCTGC;

[0058] S2-R (5'-3'): TGAAATCATGCACCATTAAC.

[0059] 3. Fine positioning

[0060] Develop new molecular marker S1 (located at the position of chromosome 1 13M, detection primer is composed of primer S1-F and primer S1-R) and molecular marker S3 (detection primer is composed of primer S3-F and primer S3-R composition).

[0061] S1-F (5'-3'): GACCTAGTGGTCTTCAATCT;

[0062] S1-R (5'-3'...

Embodiment 3

[0066] Example 3, Large-scale Genome Sequencing Gene Mapping

[0067] 1. The F obtained from Example 1 2 In the generation segregation population, the leaves of 50 plants with the phenotype of single tiller number were randomly selected, and the leaves were mixed with equal mass to extract DNA to obtain a single tiller DNA pool.

[0068] 2. Perform whole-genome sequencing on the mutant Mu1, the indica rice maintainer line Q1B, and the single tiller DNA pool obtained in step 1 (reads with a sequencing depth greater than 10 times should cover more than 90% of the genome is the best), and obtain the full-length DNA of the mutant Mu1 respectively. Genome sequencing results, whole-genome sequencing results of the indica maintainer line Q1B, and whole-genome sequencing results of the single tiller DNA pool.

[0069] 3. Compare each whole-genome sequencing data obtained in step 2 with the rice Nipponbare reference genome (specifically, BWA, GATK, samtools and other software can be u...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a gene fine mapping method adopting the map-based cloning principle and based on plant genome sequencing and inter-subspecies hybrid segregation populations. The method comprises the following steps: (1) F2-generation segregation populations are constructed by adopting a plant I and a plant II as parents, wherein the plant I is a mutant plant with the target phenotype, andthe plant B belongs to the same species with but different subspecies from the mutant plant; (2) plants with the target phenotype are screened from the F2-generation segregation populations obtained in step (1), genomic DNA is extracted, and a specific DNA pool is obtained; whole genome sequencing is performed on the plant I, the plant II and the specific DNA pool; (3) a sequencing result obtainedin step (2) is compared with a plant referent genome; (4), positioning analysis is performed on the basis of a comparison result in step (3). The method has the advantages of accurate and reliable result, time saving, labor saving and the like and can be applied to fine mapping of plant functional genes.

Description

technical field [0001] The invention relates to a gene fine positioning method for sequencing plant genomes based on the principle of map-based cloning, and the isolated population is hybridization between subspecies. Background technique [0002] Gene mapping is an important link in map-based cloning research. Map-based cloning, also known as positional cloning, was first proposed by Alan Coulson of Cambridge University in 1986. This method is used to isolate genes based on the fact that functional genes have relatively stable loci in the genome, and then On the basis of precise positioning of the target gene by using molecular marker technology, the DNA library is screened with molecular markers closely linked to the target gene, so as to construct a physical map of the target gene region, and then use this physical map to gradually approach the target gene or gene through chromosome walking. Through the method of chromosome landing, the target gene is finally cloned and ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12Q1/6895G06F19/22G06F19/18
CPCC12Q1/6895C12Q2600/156G16B20/00G16B30/00
Inventor袁运栋王永红
OwnerINST OF GENETICS & DEVELOPMENTAL BIOLOGY CHINESE ACAD OF SCI