Gene related to bm2 phenotyping, variant and molecular marker thereof

A technology of molecular markers and genes, applied in the field of plant genetic engineering, can solve the problems of loss of MTHFR function and unclear mutation mechanism

Active Publication Date: 2018-09-14
QINGDAO INST OF BIOENERGY & BIOPROCESS TECH CHINESE ACADEMY OF SCI
View PDF5 Cites 2 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

corn MTHFR There is only 1 copy of the gene ( GRAMZM2G347056 ), so its mutation will lead to loss of MTHFR function, but its mutation mechanism is not clear

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Gene related to bm2 phenotyping, variant and molecular marker thereof
  • Gene related to bm2 phenotyping, variant and molecular marker thereof
  • Gene related to bm2 phenotyping, variant and molecular marker thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0025] Example 1: Corn bm2 Mutant phenotype and molecular identification

[0026] corn bm2 The mutant seeds were obtained from the mutant library in maizegdb (www.maizegdb.org), and its Stock ID is 114A bm2-PI586725. Use ordinary nutrient soil, seed, cultivate, and continue to observe the phenotype. When the seedlings grow to about the six-leaf stage, the leaf veins appear reddish-brown phenotype ( figure 1 ). Take fresh red-brown leaf vein tissue, and take non-red (B73) leaf vein tissue as a control, use TriZol Reagent (Invitrogen, Cat. No. 15596026) to extract leaf vein total RNA, and use agarose gel electrophoresis and nucleic acid analyzer (NanoDrop) to detect total RNA 2.0 μg of total RNA was used for reverse transcription reaction. The reverse transcriptase used was M-MLV (Promega, Cat. No. M1701). For the steps of reverse transcription reaction, refer to the instructions for use of the reverse transcriptase. The first-strand cDNA synthesized by reverse transcriptio...

Embodiment 2

[0034] Embodiment 2: bm2 mutant detection probe design

[0035] Subsequently, we extracted the genomic DNA (CTAB method) of the control plant (B73) and the mutant plant (114A), and performed conventional PCR amplification using primers ZmMTHFR-proF / R ZMTHFR For the promoter region of the gene, the PCR reaction system is: 2 μL cDNA, 5 μL 10×Buffer, 4 μL dNTP (2.5 mM), forward / reverse primer (10 μM) 1 μL each, 0.5 μL Taq enzyme (5 U / μL ) and 36.5 μL ddH 2 O. Mix well after adding the sample on ice. The PCR reaction conditions are: 94 o C 5 min; 94 o C 30sec, 56 o C 45 sec; 72 o C 2 min, 34 cycles; 72 o C for 10 min. A fragment of about 2.7 kb was obtained by PCR amplification. The primer sequences are as follows:

[0036] ZmMTHFR-proF: TTAGAGTGTGGATAAAATGTACTACC

[0037] ZmMTHFR-proR: CTCGAAAACCTCACCACGAGCTT

[0038] The results of electrophoresis showed that the amplified fragment in the bm2 mutant was about 400 bp longer than the amplified fragment in B73. Subseq...

Embodiment 3

[0042] Example 3: Effect of MITE transposon on MTHFR transcription level

[0043] Based on the example shown in Example 1 bm2 mutant ZMTHFR Expression level declines and embodiment 2 shows ZMTHFR MITE transposons inserted into the gene promoter region, we analyzed the MITE transposon insertion pairs ZMTHFR Transcription effects. The method used is the detection of promoter transcription activity, and the vector used is pGREEN II 0800-LUC [Hellens et al, Transient expression vectors for functional genomic, quantification of promoter activity and RNA silencing in plants, Plant Methods, 2005, 1:13]. First of all, we will respectively obtain in the embodiment 2 in B73 respectively MTHFR Gene promoter (about 2.7 kb) and bm2 middle MTHFR The gene promoter (about 3.1 kb) was recovered using a gel extraction kit (Promega), and then ligated into the pGREEN II 0800-LUC vector using In-fusion enzyme (abm company) to form B73-5'NCR and bm2 -5' NCR recombinant plasmid, transfor...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to a gene related to bm2 phenotyping, a variant and a molecular marker thereof, and particularly pays attention to a specific naturally-existing mutant corn MTHFR gene. A MITE transposon is inserted into a gene promoter region to promote phenotyping of lignin ingredient change in a specific corn line. The invention further provides a detection method of the MITE transposon, and a new target is provided for molecular breeding in future.

Description

technical field [0001] The invention belongs to the technical field of plant genetic engineering, in particular to a mutant with maize reddish-brown veins bm2 related gene MTHFR The MITE transposon inserted in the promoter region and its molecular markers, the changed gene contributes to the phenotype of the change of maize lignin composition, and then improves the maize cell wall digestibility. Background technique [0002] corn( Zea mays L.) is an annual C4 herb belonging to the Poaceae Maize genus, which is a three-purpose crop of "grain-energy-feed". Plant cell walls are mainly composed of lignin, cellulose and hemicellulose, which are important factors in determining the efficiency of biomass energy conversion and the quality of pasture. Analyzing the regulatory mechanism related to the lignin metabolism pathway of maize, changing the lignin composition and increasing the digestibility of cell wall has important practical guiding significance for the genetic breed...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N15/113C12Q1/6895
CPCC12N9/0026C12Q1/6895C12Q2600/13C12Q2600/156
Inventor付春祥吴振映熊王丹刘雨辰苏昆龙刘金丽姜珊珊
OwnerQINGDAO INST OF BIOENERGY & BIOPROCESS TECH CHINESE ACADEMY OF SCI