Unlock instant, AI-driven research and patent intelligence for your innovation.

A fusion protein of expansin and xylanase, its encoding gene and application

A technology of fusion protein and xylanase, which is applied in the field of genetic engineering technology and biomass utilization, can solve the problems of product separation difficulty and cost increase, weakening the application prospect of xylooligosaccharides, weak hemicellulose recognition ability and binding ability, etc. , to achieve the effect of improving specific activity, reducing separation difficulty and cost

Active Publication Date: 2021-12-28
NANJING TECH UNIV +1
View PDF1 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, xylanase is usually difficult to act on insoluble xylan, and its ability to recognize and bind to hemicellulose is weak, resulting in increased separation difficulty and cost of the product, which seriously weakens the use of xylooligosaccharides in industrial production. application prospects

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • A fusion protein of expansin and xylanase, its encoding gene and application
  • A fusion protein of expansin and xylanase, its encoding gene and application
  • A fusion protein of expansin and xylanase, its encoding gene and application

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0024] This example illustrates the acquisition method of the expansin EXCL gene of the present invention.

[0025] This example illustrates the procedure for obtaining the expandin EXCL gene and xylanase XYN gene from Bacillus subtilis LC.

[0026] Bacillus subtilis LC was obtained from the preliminary screening of our laboratory, and the strain preservation registration number is CCTCC No: M208073. . The total DNA of Bacillus subtilis LC genome was extracted by the phenol-chloroform method. According to Bacillus subtilis 168 ( Bacillus subtilis 168) (NCBI Reference Sequence: CM000487.1) the whole gene sequencing results were analyzed to obtain the expansin EXCL gene and xylanase XYN gene, and the EXCL and XYN amplification primers were designed according to the gene sequence.

[0027] The EXCLF sequence is: GCCG CCATGGG GCATATGACGACCTGCATG

[0028] The EXCLR sequence is: CCG CTCGAG TTCAGGAAACTGAACATGGC

[0029] The XYNF sequence is: GCCG CCATGGG GCTAGCACAGACTACT...

Embodiment 2

[0034] This example takes the fusion protein EXCL-EK2-XYN (SEQ ID NO: 7) as an example to illustrate the acquisition of the recombinant fusion protein gene, in which EK2 is a rigid linker peptide (EKKKA) n , n=2.

[0035] Using the Bacillus subtilis LC genome as a template, the genes containing expansin EXCL (SEQ.ID.NO.1) and xylanase XYN (Genbank: KX196201, SEQ.ID.NO.2) were amplified. Design EXCL upstream primers and EXCL downstream primers:

[0036] EXCL upstream primer: GCCG CCATGGGC GCATATGACGACCTGCATG;

[0037] EXCL downstream primers:

[0038] TTTAGCCGCAGCTTCTTTTGCCGCAGCTTCTTCAGGAAACTGAACATGGC.

[0039]The upstream primer introduces the restriction endonuclease NcoI site, and the downstream primer introduces the connecting peptide (EAAAK) 2 coding genes. PCR reaction system 50 μL, in which ddH 2 O 20 μL, 10×prime star buffer mix 25 μL, Bacillus subtilis LC genome 1 μL, EXCLF1 and EXCLR1 (20 μM) each 2 μL. Design XYN upstream primers and XYN downstream primers: ...

Embodiment 3

[0045] This example takes the fusion protein EXCL-EK2-XYN as an example to illustrate the construction of the recombinant expression vector pET-EXCL-EK2-XYN and the preparation of recombinant expression transformants.

[0046] The expansin-xylanase (EXCL-EK2-XYN) PCR product was column-purified and then digested with plasmid pET-28a (+) at 37 °C overnight with NcoI and XhoI, and the purified EXCL-EK2- XYN fragment and linear band of pET-28a (+) vector. Next, use T 4 The two fragments were ligated by DNA ligase, ligated overnight at 16°C, and the ligated product was transformed into Escherichia coli BL21(DE3), spread on LB medium containing 100 μg / mL ampicanamycin and cultured overnight at 37°C. The transformant was verified by colony PCR, and the positive transformant was inoculated into liquid LB medium for expansion culture. The culture medium was extracted with the plasmid mini-extraction kit from TAKARA company and identified repeatedly by NcoI and XhoI double enzyme dige...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a fusion protein of expansion protein and xylanase, its encoding gene and application. The fusion protein includes expansin EXCL and xylanase XYN, EXCL is located at the N-terminus of the fusion protein, and XYN is located at the C-terminus of the fusion protein; wherein, the amino acid sequence of the expansion protein EXCL is shown in SEQ ID NO: 2; The amino acid sequence of carbohydrase XYN is shown in SEQ ID NO:4. The present invention also provides a preferred way of inserting a linker peptide into the fusion protein. The invention adopts the genetic engineering technology to construct the fusion enzyme of expansin and xylanase, the enzyme activity is increased by 1.3 times compared with the natural xylanase, and it has the ability to adsorb lignocellulose.

Description

technical field [0001] The invention belongs to the field of genetic engineering technology and biomass utilization, and specifically relates to the application of the fusion protein gene of expansin and xylanase and the integration of fusion protein to produce xylooligosaccharide. Background technique [0002] Corn is widely distributed in my country, with an annual output of more than 100 million tons. Corn cobs generally account for 20.0%~30.0% of the weight of corn ears, and have high hemicellulose content, which is a natural renewable resource. Xylooligosaccharides or xylooligosaccharides are oligosaccharides formed by connecting 2 to 10 xylose molecules with β-1,4 glycosidic bonds. Xylooligosaccharides are difficult to be decomposed by the human digestive enzyme system and can directly enter In the large intestine, on the one hand, it is absorbed and metabolized by the probiotics in the intestine, such as bifidobacteria and lactic acid bacteria, and proliferates in la...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Patents(China)
IPC IPC(8): C07K19/00C12N15/62C12N15/63C12P19/14
CPCC12N9/248C12P19/14C07K14/32C07K2319/00
Inventor 吴斌韦利军常思源何冰芳储建林
Owner NANJING TECH UNIV