Unlock instant, AI-driven research and patent intelligence for your innovation.

Method for identifying relative relationship of liriodendron hybrid

A technology for hybridization of Liriodendron tulipifera and kinship, which is applied in the field of tree species identification, can solve the problems of large environmental influence of morphological markers, low accuracy of kinship identification, and low germination rate, and achieves good repeatability and stability and high speed. , the result is accurate

Active Publication Date: 2018-10-16
NANJING FORESTRY UNIV
View PDF1 Cites 4 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, due to the poor natural pollination and low germination rate of Liriodendron genus plants, the way to obtain hybrids is mainly artificial pollination or grafting.
The existing methods are relatively complicated, and people have been looking for more convenient and effective methods
[0004] The traditional identification of the kinship of Liriodendron chinensis mainly uses the difference in shape expression to identify and distinguish, such as morphology, anatomy, and isozyme zymography. However, morphological markers are greatly affected by the environment, and isozyme markers Also affected by gene expression limiting its use
The emergence of SSR molecular markers has solved some of the difficulties in genetic relationship identification to a certain extent, but there are still deficiencies such as low precision of genetic relationship identification, which still cannot meet the needs.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Method for identifying relative relationship of liriodendron hybrid
  • Method for identifying relative relationship of liriodendron hybrid

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0026] A kind of hybrid Liriodendron phylogenetic identification method, comprises the following steps:

[0027] 1) Take the leaves of Liriodendron chinensis hybrid at the seedling stage, which are young leaves that have just unfolded, and place them at -80°C after being treated with liquid nitrogen for later use; the DNA of the leaves is extracted by the CTAB method.

[0028] 2) Use the extracted DNA as a template to perform two PCR tests before and after;

[0029] For the first time detection with primer 18.2, the female parent that can specifically amplify a 400bp product is Liriodendron chinensis, and the female parent that can specifically amplify a 382bp product is Liriodendron tulipifera; the specific PCR system and PCR program are as follows :

[0030] The 10μL system for PCR amplification is: 75ng genomic DNA, 1.0μL 10×PCR Buffer, 1.2μL 2.5mM·L - 1 MgCl, 0.2μL 10mM·L -1 dNTPs, 0.5 μL 10 μM·L -1 Primer 18.2 left end primer, 0.5 μL 10 μM L -1 Primer 18.2 right end...

Embodiment 2

[0039] The special kit for the method of Example 1 at least includes a primer reagent with an amount of more than 1 time. The primer reagent has two pairs of primers in total, and the amount can be detected more than 25 times. The specific primer sequence is:

[0040] The primer sequence at the left end of primer 18.2 is: AATTCTCTCAATTTCACTTTGCCT;

[0041] The primer sequence at the right end of primer 18.2 is: TGGTCGATGCATTCTGTTTCT;

[0042] The sequence at the left end of primer 700 is: TATGGTATATTCTATTCGGTT;

[0043] The sequence at the right end of primer 700 is: TCATTCCAATTCTACCGAT.

[0044] Preferably, the special kit includes DNA standard sample reagents for more than 25 detections, DNA extraction reagents for more than 25 detections, PCR reagents for more than 25 detections, and electrophoresis reagents for more than 25 detections; wherein,

[0045] The DNA standard contains at least four bands of 242bp, 382bp, 400bp and 700bp;

[0046] DNA extraction reagents: nece...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a method for identifying relative relationship of liriodendron hybrid and a special kit thereof. The method comprises the following steps that (1) DNA (deoxyribonucleic acid) of leaves of the liriodendron hybrid is extracted; (2) the PCR (polymerase chain reaction) detection is performed; (3) a primer 18.2 is used for specifically amplifying a female parent of the 400bp product as Chinese liriodendron, and specifically amplifying a female parent of the 382bp product as North American liriodendron; a primer 700 is used for performing PCR amplification on the Chinese liriodendron, specifically amplifying a female parent of the 700bp product as the western seed source of the Chinese liriodendron, and specifically amplifying a female parent of the 242bp product as the eastern seed source of the Chinese liriodendron; when the PCR amplification is performed on the North American liriodendron by the primer 700, the 700bp product can be specifically obtained. The methodhas the advantages that the natural forest of liriodendron hybrid in the seedling stage can be effectively verified; the speed is quick, the efficiency is high, the result is accurate, the repeatability and stability are good, and the like.

Description

technical field [0001] The invention belongs to the technical field of tree species identification, and in particular relates to an identification method for the genetic relationship of hybrid tulip tree. Background technique [0002] Liriodendron L. is a plant belonging to the family Magnoliaceae, which is one of the ancient genera. Now it includes three species: Liriodendron chinense (Hemsl.) Sarg., Liriodendron tulipifera Linn. and the hybrid Liriodendron chinense×tulipifera. Liriodendron is an ideal material for studying the evolutionary history of plants, and has important research significance. [0003] Liriodendron chinensis has a straight trunk and can be used as wood. It has three-lobed leaves in the shape of a mandarin jacket and has high ornamental value. It belongs to the national second-class rare and endangered protected plant. Liriodendron tulipifera is excellent in material, light yellowish brown, dense and beautiful in texture, smooth in machinability, and...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12Q1/686C12Q1/6895
CPCC12Q1/686C12Q1/6895C12Q2600/13
Inventor 陈金慧龙晓飞施季森成铁龙肖保荣刘思芹翁禹豪胡凌峰刘阳
Owner NANJING FORESTRY UNIV
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More