Method for identifying relative relationship of liriodendron hybrid
A technology for hybridization of Liriodendron tulipifera and kinship, which is applied in the field of tree species identification, can solve the problems of large environmental influence of morphological markers, low accuracy of kinship identification, and low germination rate, and achieves good repeatability and stability and high speed. , the result is accurate
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0026] A kind of hybrid Liriodendron phylogenetic identification method, comprises the following steps:
[0027] 1) Take the leaves of Liriodendron chinensis hybrid at the seedling stage, which are young leaves that have just unfolded, and place them at -80°C after being treated with liquid nitrogen for later use; the DNA of the leaves is extracted by the CTAB method.
[0028] 2) Use the extracted DNA as a template to perform two PCR tests before and after;
[0029] For the first time detection with primer 18.2, the female parent that can specifically amplify a 400bp product is Liriodendron chinensis, and the female parent that can specifically amplify a 382bp product is Liriodendron tulipifera; the specific PCR system and PCR program are as follows :
[0030] The 10μL system for PCR amplification is: 75ng genomic DNA, 1.0μL 10×PCR Buffer, 1.2μL 2.5mM·L - 1 MgCl, 0.2μL 10mM·L -1 dNTPs, 0.5 μL 10 μM·L -1 Primer 18.2 left end primer, 0.5 μL 10 μM L -1 Primer 18.2 right end...
Embodiment 2
[0039] The special kit for the method of Example 1 at least includes a primer reagent with an amount of more than 1 time. The primer reagent has two pairs of primers in total, and the amount can be detected more than 25 times. The specific primer sequence is:
[0040] The primer sequence at the left end of primer 18.2 is: AATTCTCTCAATTTCACTTTGCCT;
[0041] The primer sequence at the right end of primer 18.2 is: TGGTCGATGCATTCTGTTTCT;
[0042] The sequence at the left end of primer 700 is: TATGGTATATTCTATTCGGTT;
[0043] The sequence at the right end of primer 700 is: TCATTCCAATTCTACCGAT.
[0044] Preferably, the special kit includes DNA standard sample reagents for more than 25 detections, DNA extraction reagents for more than 25 detections, PCR reagents for more than 25 detections, and electrophoresis reagents for more than 25 detections; wherein,
[0045] The DNA standard contains at least four bands of 242bp, 382bp, 400bp and 700bp;
[0046] DNA extraction reagents: nece...
PUM
Abstract
Description
Claims
Application Information
- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap