Pictet-Spengler enzyme and encoding gene and application thereof

A technology of encoding gene and transgenic cell line, applied in Pictet-Spengler enzyme and its encoding gene and application field, can solve problems such as restricting application, restricting family enzyme system research, etc., and achieving the effect of enhancing cognition

Active Publication Date: 2018-10-26
ANHUI MEDICAL UNIV
View PDF1 Cites 2 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0004] However, so far, the only P-S enzyme identified from bacteria is McbB, and the report on the formation of β-carboline and its derivatives using the corresponding enzyme is even rarer, which restricts the systematic study of this family of enzymes and limits Its application in biology, medicine, fine chemical industry, etc.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Pictet-Spengler enzyme and encoding gene and application thereof
  • Pictet-Spengler enzyme and encoding gene and application thereof
  • Pictet-Spengler enzyme and encoding gene and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0048] Extraction of Actinomycete Nocardiopsis flavescens CGMCC 4.5723 Genomic DNA:

[0049] The fresh spores of actinomycete Nocardiopsis flavescens CGMCC 4.5723 were inoculated into 50 mL of TSB medium (tryptone 17g, plant peptone 3g, sodium chloride 5g, dipotassium hydrogen phosphate 2.5g, glucose 2.5g according to the inoculum size of 5% by volume fraction) , add water to 1L, pH 7.2-7.4), 28-30°C, culture with shaking for about 2 days, and centrifuge at 4000r / min for 10min to collect mycelia. The mycelium was washed twice with STE solution (NaCl 75mmol / L, EDTA 25mmol / L, Tris-HCl 20mmol / L, and the balance was water), and 30mL of STE solution and a final concentration of 3mg / L were added to the washed mycelium. 3 mL of lysozyme, vortex evenly, incubate at 37°C for 3h, add proteinase K to a final concentration of 0.1-0.2mg / mL, mix well, incubate at 37°C for 10min, add SDS to a final concentration of 1-2%, mix well, Put it in a water bath at 55°C for about 1 hour, and invert ...

Embodiment 2

[0051] Expression of NfcbB encoding gene nfcbB in E.coli BL21(DE3):

[0052] Using the genomic DNA of Nocardiopsis flavescens CGMCC 4.5723 as a template, primers were designed. The F sequence of the upstream primer is: CATATGCGCCAGCTAGAGATCGAA, and the restriction site is Nde I; the R sequence of the downstream primer is: AAGCTTTCACCCCCGGGGGTAGGGGTA, and the restriction site is Hind III. The gene nfcbB was amplified by PCR, and the PCR reaction system was: (50 μL system): 5×Fast Pfu Buffer 10 μL, dNTP Mix 5 μL, upstream primer F (10 μM) 1.5 μL, downstream primer R (10 μM) 1.5 μL, DMSO 3 μL, Template 10ng, Fast Pfu DNA Polymerase 0.5μL, ddH 2 O 27.5 μL. The reaction conditions and cycle parameters were: 95°C pre-denaturation for 5 min; 95°C denaturation for 50 sec, 60°C for 50 sec, 72°C for 1.5 min, 30 cycles; 72°C extension for 10 min. The obtained PCR product was sequentially recovered by gel, adding an "A" tail, TA cloning, and sequencing verification (the nucleotide seque...

Embodiment 3

[0054] Detection of fermentation and metabolites of recombinant strain E.coli BL21(DE3) / pET28a(+) / nfcbB:

[0055] Streak culture the obtained recombinant expression strain E.coli BL21(DE3) / pET28a(+) / nfcbB onto LB solid plate, pick a single clone after overnight culture at 37°C, and inoculate at an inoculum size of 1% by volume fraction Put 50mL of LB culture liquid into a 250mL Erlenmeyer flask, and culture it on a shaker at 28°C at 180r / min until OD 600 At about 0.6, add isopropyl-β-D-thiogalactopyranoside (IPTG) at a final concentration of 0.1 mM to the culture medium. After continuing to incubate at 28°C for 12 hours, add an appropriate amount of 1 mol / L HCl to the fermented product to adjust its pH to 5, add twice the volume of ethyl acetate, and sonicate for 5 minutes to disrupt the cells, and then let stand to separate. The ethyl acetate extract was separated from the water phase, and the ethyl acetate was evaporated to dryness with a rotary evaporator, and the residue ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

PropertyMeasurementUnit
molecular weightaaaaaaaaaa
Login to View More

Abstract

The invention discloses a Pictet-Spengler enzyme and an encoding gene and application thereof. The encoding gene nfcbB of the Pictet-Spengler enzyme is as shown in the nucleotide sequence of SEQ ID NO. 1, and NfcbB of the Pictet-Spengler enzyme is as shown in the nucleotide sequence of SEQ ID NO. 2. beta-carboline framework 1-acyl-3-carboxyl-beta-carboline can be produced by constructing recombinant escherichia coli BL21 (DE3) containing the nfcbB gene, and purified NfcbB can catalyze L-tryptophan and pyroracemic aldehyde to react to produce the beta-carboline framework 1-acyl-3-carboxyl-beta-carboline. The discovery and functional identification of the NfcbB have practical guiding significance for the large-scale production of alkaloids, and the NfcbB is applicable to the fields of biology, medicine, fine chemical industry and the like.

Description

Technical field: [0001] The invention belongs to the technical field of bioengineering, and in particular relates to a Pictet-Spengler enzyme and its encoding gene and application. Background technique: [0002] Pictet-Spengler (P-S) reaction refers to the reaction of compounds with phenethylamine structure with aldehydes or ketones to form Schiff bases, followed by Friedel-Crafts cyclization to form isoquinoline or β-carboline alkaloids. This reaction is widely used in the construction of natural products and novel heterocyclic substances in organic chemistry. It was first discovered by Pictet and Spengler in 1911, and it is still the most efficient method for the synthesis of tetrahydroisoquinoline and β-carboline derivatives even though it has a hundred years of history. In nature, tetrahydroisoquinoline and β-carboline are two types of alkaloids with important biological activities such as antiviral, antitumor, antibacterial, and antioxidative. Therefore, as a fundamen...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityApplications(China)
IPC IPC(8): C12N9/00C12N15/52C12P17/18
CPCC12N9/00C12P17/182
Inventor陈奇谢运昌刘晓颖滕衍斌刘刚张少飞
OwnerANHUI MEDICAL UNIV