Eureka AIR delivers breakthrough ideas for toughest innovation challenges, trusted by R&D personnel around the world.

Tripterygium wilfordii triterpene synthase twosc3 and its coding gene and application

A coding and amino acid technology, applied in application, genetic engineering, plant genetic improvement, etc., can solve the problems of restricted development, slow growth of plants, and low content.

Active Publication Date: 2019-06-04
CAPITAL UNIVERSITY OF MEDICAL SCIENCES
View PDF12 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

It is a very potential way to develop new drugs from the active ingredients in traditional Chinese medicine. However, due to the slow growth of plants and the low content of these active ingredients in plants, its development is greatly limited.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Tripterygium wilfordii triterpene synthase twosc3 and its coding gene and application
  • Tripterygium wilfordii triterpene synthase twosc3 and its coding gene and application
  • Tripterygium wilfordii triterpene synthase twosc3 and its coding gene and application

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0056] Embodiment 1, the cloning of Tripterygium wilfordii Twosc3 full-length cDNA sequence

[0057] 1. Extraction of total RNA from tripterygium wilfordii suspension cells and first-strand cDNA acquisition

[0058] Using improved CTAB method (CTAB Buffer: 2% CTAB (W / V); 100mmol L -1 Tris-HCl (pH 8.0); 25mmol L -1 EDTA; 2.0mol L -1 NaCl; 0.5g L -1 spermidine) to extract the total RNA of Tripterygium wilfordii suspension cells. The obtained total RNA was used as a template, and the 5'-CDSprimer in the SMARTerTM RACE cDNA Amplification Kit was used to perform reverse transcription to obtain 5'-RACE-Ready cDNA.

[0059] 2. Primer Design

[0060] The full-length sequence fragment of the gene was screened according to the transcriptome data annotation of Tripterygium wilfordii, and Twosc3-F and Twosc3-R primers were designed. The primer sequences are as follows:

[0061] Twosc3-F: AAACACAAGAGATTGATATAAGC (SEQ ID NO: 3)

[0062] Twosc3-R: TTCGATTTAGCGGACACT (SEQ ID NO: 4)

...

Embodiment 2

[0092]Embodiment 2, Twosc3 gene tissue expression analysis

[0093] 1. Handling of Experimental Materials

[0094] The roots, stems, leaves, and flowers of Tripterygium twig are collected from five different plants in the Yongan State-owned Forest Farm in Fujian. The samples were taken back to the laboratory for cleaning, quick-frozen in liquid nitrogen and stored in a minus 80 refrigerator.

[0095] 2. Extraction of total RNA and real-time quantitative PCR

[0096] The roots, stems, leaves, and flowers stored in the negative 80 refrigerator were crushed in a liquid nitrogen environment, and the total RNA was extracted by the improved CTAB method, and reverse-transcribed into cDNA with the FastQuant RT Kit (Tiangen). as an internal reference. Real-time quantitative PCR was performed using ABIPrism 7300 Sequence Detection System (Applied Biosystems, USA) and KAPA SYBR FASTUniversal 2X qPCR Master Mix (Kapa Biosystems, USA) kit. Real-time fluorescence quantitative reaction s...

Embodiment 3

[0102] Example 3, research on the biological function of Tripterygium wilfordii Twosc3

[0103] 1. Construction of eukaryotic expression vector

[0104] The vector pEASY-Blunt-Twosc3 plasmid containing the full-length cDNA of Tripterygium wilfordii Twosc3 gene was used as a template, and the gene coding region was amplified by PCR with primers containing restriction sites (marked with a horizontal line is the restriction site). DNA polymerase adopts high-fidelity DNA polymerase (Phusion High-Fidelity PCR Master Mix). The PCR parameters were 98°C for 30s, 1 cycle; 98°C for 10s, 60°C for 10s, 72°C for 2min 30s, 35 cycles; 72°C for 5min; 4°C for maintenance. The amplified product was recovered by Gene JET GelExtraction Kit gel (method as follows).

[0105] Twosc3-F:CGG GGTACC ATGTGGAAGATAAAGATAGCTGA (SEQ ID NO: 9)

[0106] Twosc3-R:CGC GGATCC CTATTTAATTTCCTTTGAAGGC (SEQ ID NO: 10)

[0107] Gene JET Gel Extraction Kit glue recovery step (with the glue recovery step in the ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to a triterpene synthase of tripterygium wilfordii TwOSC3 protein and an encoding gene thereof. A recombinant expression vector with a Twosc3 gene is constructed by cloning cDNAof the Twosc3 gene onto a eukaryotic expression vector pYES2, and then the recombinant expression vector is shifted to yeast expression host bacteria, so as to acquire friedelin. A mutation research result shows that amino acid 482 encoded by the Twosc3 gene is a key site, and the yield of friedelin or amyrin can be increased or reduced; a gene gun mediated interference experiment shows that the interference of the Twosc3 gene has an obvious inhibiting effect on the synthesis of celastrol in tripterygium wilfordii; the TwOSC3 protein and the encoding gene thereof provided by the invention canbe used for biosynthesizing plant triterpenoids and cultivating high-quality tripterygium wilfordii.

Description

technical field [0001] The invention relates to tripterygium wilfordii triterpene synthase and its encoding gene, and the application of the triterpene synthase and its encoding gene in the biosynthesis of triterpenoids, belonging to the field of medicinal plant genetic engineering. Background technique [0002] The traditional Chinese medicine Tripterygium wilfordii, derived from the xylem of the dried root of the medicinal plant Tripterygium wilfordii. Hook.f., is widely used in the treatment of rheumatoid arthritis and inflammation (Raphaela G M, Mildred W, Roy F, et al .Comparison of Tripterygium wilfordii Hook F Versus Sulfasalazine in the Treatment of Rheumatoid Arthritis:A Randomized Trial[J].Annals of Internal Medicine,2009,151(4):229-240.Tao X L,Lipsky P E.The Chinese anti-inflammatory and immunosuppressive herbal remedy Tripterygium wilfordii Hook F. [J]. Rheumatic Disease Clinics of North America, 2000, 26(1):29–50.). Terpenes are the main active ingredients of T...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Patents(China)
IPC IPC(8): C12N9/90C12N15/61C12N5/10C12P33/00
CPCC12N9/90C12P33/00C12Y504/99007
Inventor 高伟周家伟胡添源
Owner CAPITAL UNIVERSITY OF MEDICAL SCIENCES
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com