Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Overexpression of GhCIPK6 to increase water use efficiency and promote soluble sugar accumulation in plants

A soluble, gene-based technology, applied in the field of plant genetic engineering, which can solve problems such as the complexity of CIPK regulation

Active Publication Date: 2019-01-15
HUAZHONG AGRI UNIV
View PDF9 Cites 3 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Active oxygen plays an important role in various stress resistance, and CIPK is also involved in the regulation of active oxygen. Among them, AtCIPK26 interacts with AtRbohF to negatively regulate the generation of active oxygen ROS [13], which is consistent with the report of AtCIPK26 and AtCBL1 by Drerup MM et al. / 9 interaction phosphorylates AtRbohF and increases reactive oxygen species ROS [14] are inconsistent, indicating the complexity of CIPK regulation, which needs further verification

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Overexpression of GhCIPK6 to increase water use efficiency and promote soluble sugar accumulation in plants
  • Overexpression of GhCIPK6 to increase water use efficiency and promote soluble sugar accumulation in plants
  • Overexpression of GhCIPK6 to increase water use efficiency and promote soluble sugar accumulation in plants

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0032] Example 1 Cloning and expression pattern analysis of GhCIPK6 gene

[0033] A. RNA extraction and cDNA acquisition

[0034] The samples of somatic embryogenesis of the upland cotton line (YZ1, also known as Yuzaoshu No. 1, from the Economic Crops Research Institute of Henan Academy of Agricultural Sciences) were taken at different stages, and the total RNA and cDNA were extracted by the method of guanidine isothiocyanate. The synthesis was based on 2 μg total RNA as a template, mixed with 1 μl 500 μg / ml oligo-dT(15) primer (purchased from Promega), DEPC-water, and the total volume was 14 μl; then denatured at 70°C for 5 minutes and quenched on ice; then added 10μl contains 5μl RT buffer, 1.25μl 10mM dNTP, 1.75μl DEPC-water, 1μl Mixture of Ribonuclease Inhibitor (purchased from Promega, USA) and 1 μl Superscript III reverse transcriptase (purchased from Invitrogen, USA); warm bath at 42°C for 1h to synthesize the first strand; after the reaction, treat at 70°C for 15min...

Embodiment 2

[0042] Embodiment 2: Construction of GhCIPK6 gene overexpression vector

[0043] A. Construction of overexpression vector

[0044] will clone into pDONR TM GhCIPK6 on 221 was recombined into the plant expression vector pK2GW7.0 by LR reaction (Invitrogen) (wherein: LR enzyme was purchased from Invitrogen Company, the United States; reacted at room temperature for 4 hours, and the vector construction map is shown in figure 2 ; The intermediate vector pK2GW7.0 is from Ghent University in Belgium), and the reaction product is used to transform Escherichia coli competent cell TOP10. After 10-12 hours, a single clone is picked for PCR positive detection, and the primers are 35S-S: CCACTATCCTTCGCAAGACCCT and GhCIPK6-RT- A: AATCAAGCCACAGTCGAGTTCTC, the PCR reaction conditions are: 94°C pre-denaturation for 5 minutes; 94°C for 30 sec, 58°C for 30 sec, 72°C for 1 min, 28 cycles; 72°C for 5 min. The positive single clone was amplified and the plasmid was extracted to obtain the overe...

Embodiment 3

[0047] Example 3 Genetic transformation and screening identification of GhCIPK6 gene

[0048] A. Agrobacterium-mediated genetic transformation

[0049] The test material is the upland cotton strain (YZ1). The plump and consistent YZ1 seeds are selected, the seed coat is peeled off, and sterilized with 0.1% mercury chloride solution for 10-12 minutes. on the surface of MS medium. After 1 day of dark culture at 30°C, seedlings were supported, and dark culture was continued for 4-5 days.

[0050]Take out the glycerol tube of the EHA105 strain containing the target gene (i.e. the cloned GhCIPK6 gene of the present invention) stored in the ultra-low temperature refrigerator, melt it on ice, add 10 μl to 2 ml of LB liquid containing 100 mg / L spectinomycin, and culture with shaking at 28°C On day 1, add 20ul of the activated bacterial solution to 15-20ml of fresh liquid LB containing 100mg / L spectinomycin, culture overnight at 28°C with shaking, draw 1ml of the turbid bacterial sol...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention belongs to the technical field of plant genetic engineering and relates to overexpression of GhCIPK6 to increase water use efficiency and promote soluble sugar accumulation in plants. GhCIPK6 gene cloned from cotton is a key member of CIPK protein family. The cDNA sequence of GhCIPK6 gene is shown in SEQ ID NO: 1, and the protein sequence encoded by GhCIPK6 gene is shown in SEQ ID NO: 2. The invention relates to a superexpression vector pK2GW7.0-GhCIPK6 for constructing the gene. The transformation of vector could increase the water use efficiency of cotton and the content of soluble sugar in cotton leaves.

Description

technical field [0001] The invention belongs to the technical field of plant genetic engineering. It specifically relates to the application of the GhCIPK6 gene of cotton in improving plant water use efficiency and promoting the accumulation of soluble sugar. The invention relates to constructing the GhCIPK6 cloned in cotton to the overexpression vector pKGWFS7.0, and through the genetic transformation mediated by Agrobacterium, the cotton can significantly improve the water utilization efficiency, and at the same time, the soluble sugar content of the cotton leaves can be significantly increased. Background technique [0002] Cotton is an important economic crop, and transgenic technology, as a fast and effective method for cotton genetic improvement, has brought huge development space for cotton genetic breeding. Insect-resistant cotton cultivated through genetic engineering technology has become the most successful transgenic crop in my country. It has effectively improv...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12N15/54C12N15/82A01H5/00A01H6/60
CPCC12N9/1205C12N15/8243
Inventor 杨细燕邓晋武何良荣张献龙
Owner HUAZHONG AGRI UNIV
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com