A method for improving cotton properties

A cotton and trait technology, applied in the field of cotton trait improvement, can solve the problems of the complexity of cotton genetic background, the loss of spontaneous mutant pool resources, etc.

Active Publication Date: 2021-08-03
ZHEJIANG SCI-TECH UNIV
View PDF13 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Due to the low probability of spontaneous mutations and the complexity of the genetic background of cotton, even if some phenotypic variations are found, it is difficult to verify with molecular mechanisms, which eventually leads to the loss of resources in the spontaneous mutant library.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • A method for improving cotton properties
  • A method for improving cotton properties
  • A method for improving cotton properties

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0052] Example 1 Acquisition and Gene Cloning of Cotton Violet Senescence-Resistant Mutants

[0053] 1. Acquisition of purple senescence-resistant mutants in cotton

[0054] The constructed T-DNA expression vector (pBI121) was transferred to Agrobacterium LB4404 for expanded culture, and the hypocotyls of cotton C312 seedlings were mixed with Agrobacterium LB4404 loaded with T-DNA vector in induction medium (MSB5 medium + 2,4- D (2,4-dichlorophenoxyacetic acid) 0.1 mg / L + KT (cytokinin) 0.1 mg / L) at 23°C for 36-48 hours. The embryogenic callus was washed with sterile water containing cephalosporin (500 mg / L). The embryogenic callus after cleaning is transferred to the resistance selection medium (MSB5 medium+IBA (indole acetic acid) 0.5mg / L+KT0.15mg / L+kanamycin 50mg / L) to screen for successful transformation Embryogenic callus. Inoculate the different callus pieces that differentiated and grown on the subculture medium (MSB5 medium+IBA0.5mg / L+KT 0.2mg / L) respectively, pick ...

Embodiment 2

[0093] Example 2 Using RNAi to interfere with the GhOMT1 gene to cultivate purple senescence-resistant transgenic cotton

[0094] (1) Cloning the full-length GhOMT1 gene (shown in SEQ ID NO.1) according to Example 1, inserting the GhOMT1 gene forward into the plant expression vector pBI121-35S-NOS, using the CaMV35S promoter to promote expression, and constructing a GhOMT1 gene containing Gene plant expression vector pBI21-35S-GhOMT1-NOS, such as Figure 4 .

[0095] Insert the GhOMT1 gene fragment (shown in SEQ ID NO.1) into the plant interference expression vector pB7GWIWG2(II), use the CaMV35S promoter to promote expression, and construct the plant interference expression vector pB7GWIWG2(II)-GhOMT1-F- containing the GhOMT1 gene T35S, such as Figure 5 .

[0096] The constructed vector was heat-shocked to transform DH-5α Escherichia coli competent, and during this process, kanamycin LB medium was used to cultivate the recombinant. The plasmid pB7GWIWG2(II)-GhOMT1 extract...

Embodiment 3

[0099] Example 3 Using CRISPR-Cas9 Technology to Knockout the GhOMT1 Gene to Cultivate Violet Senescence-resistant Transgenic Cotton

[0100] 1. CRISPR / Cas9 system gene knockout vector of cotton GhOMT1 gene

[0101] 1) In order to obtain the 18-23bp guideRNA of the target gene GhOMT1 sequence, the only restrictive conditions for determining the target site according to the CRISPR / Cas9 system are the PAM site at the 3' end and the 18-22bp gRNA sequence at the front of the PAM. Look for the 23bp site, the standard recognition site form is GN19NGG, where NGG is the PAM sequence required for protein binding to the genome, and does not need to appear on the constructed vector, only the 20bp of GN19 in front of NGG needs to be placed in the vector. The first G in GN19 is the initiation signal required for small RNA transcription.

[0102] The guideRNA (gttccttttagtaaggcata) of the target gene GhOMT1 sequence was used to synthesize upstream and downstream primers (5'-GATTGN19-3', 3'...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

PropertyMeasurementUnit
wavelengthaaaaaaaaaa
Login to View More

Abstract

The invention discloses a method for improving cotton traits, which is to inhibit or knock out the cotton anthocyanin methylation modification gene GhOMT1. The change of the cotton character of the present invention, by regulating the expression of the anthocyanin modification gene in the anthocyanin metabolic pathway, leads to the inability to synthesize the specific anthocyanin or anthocyanin that the cell needs, and changes the composition and content of the anthocyanin monomer , the feedback activates anthocyanin biosynthesis, resulting in the accumulation of a large amount of anthocyanins or intermediates, making the plant appear purple, and has anti-aging and anti-freezing properties.

Description

[0001] (1) Technical field [0002] The invention relates to a method for cultivating purple, cold-resistant and anti-aging cotton by using the cotton anthocyanin methylation modification gene. [0003] (2) Background technology [0004] Cotton is one of the world's major fiber crops. Spontaneous plant mutations usually occur under natural conditions without the intervention of human factors. Wang Xuede reported the discovery of a fiberless cotton mutant in 2002, which provided materials for the study of cotton fiber generation mechanism and the cloning of cotton fiber-related genes (Jiang Shuli, Wang Xuede, Induction of ovules and fibers of 5 cotton fiber mutants in vitro, Cotton Journal, 2002, 14(2):71-75, 2002). Chen Xusheng et al. isolated naturally mutated subred mutants with high photosynthetic efficiency from upland cotton, and then found spontaneously mutated dwarfed strains (Chen Xusheng, cotton dwarf mutants, Cotton China, 2004, 31 (1): 26-26; Chen Xusheng, New Mut...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityPatents(China)
IPC IPC(8): C12N15/82A01H5/00A01H6/60
CPCC12N15/8213C12N15/825C12N15/8273
Inventor柯丽萍孙玉强
OwnerZHEJIANG SCI-TECH UNIV