Xylanase mutants

A xylanase mutation and xylanase technology, which is applied in the field of protein engineering transformation, can solve problems such as the inability to meet industrial production needs, and achieve the effects of remarkable heat resistance and improved heat resistance.

Active Publication Date: 2019-03-01
WEIFANG KANGDIEN BIOTECH +1
View PDF16 Cites 15 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0007] Although a lot of research has improved the stability of xylanase, it still cannot meet the increasing demand for industrial production. Therefore, it is of great practical significance to provide a high-temperature resistant xylanase suitable for industrial production.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Xylanase mutants
  • Xylanase mutants
  • Xylanase mutants

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0069] The amplification of embodiment 1 xylanase gene

[0070] Xyn-F1: 5'—CGC GAATTC ACTATTCAACCTGGAACTGGATAC—3' (the underline is the restriction endonuclease ECORI recognition site)

[0071] Xyn-R1: 5'-CT CGCGGCCGC TTATGAGACTGTGATAGAGGCAG—3' (the underline is the restriction endonuclease NOTI recognition site)

[0072] Using the Trichoderma reesei genome as a template, PCR amplification was performed using the above primers Xyn-F1 and Xyn-R1, the PCR product was recovered from the gel, connected to the pEASY-T vector, transformed into E. coli DH5a, and the correct Transformants were sequenced. Sequencing results showed that the nucleotide sequence of the xylanase in the transformant was SEQ ID NO: 2, and the encoded amino acid sequence was SEQ ID NO: 1. Applicants named the xylanase Xyn.

Embodiment 2

[0073] Example 2 Screening and Obtaining of Heat-resistant Mutant Genes

[0074] Disulfide bridges (ie, Cys-Cys bridges) can stabilize the enzyme structure. A certain amount of stabilizing disulfide bridges is necessary to maintain proper stability of the enzyme. By artificially introducing a certain number of disulfide bridges into the protein structure, it is expected that more stable, especially heat-resistant, but possibly less active enzyme mutants can be produced.

[0075] In order to improve the heat resistance of xylanase Xyn, the applicant modified it by analyzing the sequence and structure of xylanase Xyn (crystal structure PDB ID: 2JIC). The modification is to introduce one or more unnatural disulfide bridges by site-directed mutation, for example, introduce unnatural disulfide bridges T1C-T27C to stabilize the N-terminal region of Xyn protein, introduce disulfide bridges S109C-N153C to Stabilizes the α-helical region and introduces a disulfide bridge Q33C-T187C t...

Embodiment 3

[0079] The construction of embodiment 3 pichia pastoris engineering strain

[0080] The xylanase mutant gene XynA1 and XynA2 fragments cloned above were connected to the expression vector pPIC9K through the EcoRI and Not I sites to construct the expression vectors pPIC9K-XynA1 and pPIC9K-XynA2.

[0081]The mutant expression plasmid was linearized with Sal I, and the linearized fragment of the expression plasmid was transformed into Pichia pastoris GS115 by electroporation, and the recombinant strains of Pichia pastoris GS115 / pPIC9K-XynA1 and GS115 / pPIC9K-XynA2 were obtained by screening on MD plates , and then screen multi-copy transformants on YPD plates containing different concentrations of geneticin.

[0082] The positive transformants of the screened recombinant expression xylanase mutants XynA1 and XynA2 were named Pichia pastoris XynA1 (Pichia pastoris XynA1) and Pichia pastoris XynA2 (Pichia pastoris XynA2), respectively, and then respectively transferred to BMGY mediu...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

PropertyMeasurementUnit
molecular weightaaaaaaaaaa
molecular weightaaaaaaaaaa
Login to View More

Abstract

The invention relates to the technical field of protein engineering modification, in particular to xylanase mutants with improved heat resistance. Two or more unnatural disulfide bridges are manuallyintroduced into xylanase with a site-directed mutation method, the mutants XynA1 and XynA2 with improved heat resistance are obtained, and particularly, for the mutant XynA2 with three disulfide bridges introduced, enzyme activity residual rate of the mutant XynA2 after 5 min treatment at 80 DEG C is as high as 75% and is increased by 72% compared with that of the mutant XynA1. Three mutation sites Q51N, H143K and Q161F capable of improving heat resistance of the mutants remarkably are obtained by further screening, xylanase XynA1 and xylanase XynA2 are introduced into the mutation sites in amode of single-point, two-point combination or three-point combination, and heat resistance can be effectively improved.

Description

technical field [0001] The invention relates to the technical field of protein engineering, in particular to a xylanase mutant with improved heat resistance. Background technique [0002] Xylan is the main component of plant hemicellulose, widely present in crop wastes such as corncobs, bagasse, wheat bran, straw, etc., because xylanase can decompose xylan into oligomeric wood of different lengths Sugar and xylose, this product has important economic value, and these available resources can be fully utilized by xylanase to exert its potential application value, and the research of xylanase has also received sufficient attention. [0003] Xylanases are glycosyl hydrolases that hydrolyze β-1,4-linked xylopyranoside chains, have been shown to exist in at least hundreds of different organisms, and can be economically produced on a large scale. Together with other glycosyl hydrolases, they form a superfamily comprising more than 40 different enzyme families. Trichoderma reesei ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityApplications(China)
IPC IPC(8): C12N9/42C12N15/56C12N15/81C12R1/84
CPCC12N9/2482C12N15/815C12Y302/01008C12N9/2402
Inventor吴秀秀邵弨黄亦钧
OwnerWEIFANG KANGDIEN BIOTECH