Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Cloning and application of maize drought-resistant gene ZmDSR

A corn, gene technology, applied in the application, genetic engineering, plant genetic improvement and other directions, to achieve the effect of improving stress resistance

Active Publication Date: 2019-03-29
SOUTHWEST UNIVERSITY
View PDF2 Cites 4 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0004] The purpose of the present invention is to clone the drought-resistant gene in the corn genome, create a drought-resistant transgenic corn material, and solve the problem of plant growth and development under high temperature and drought adversity conditions

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Cloning and application of maize drought-resistant gene ZmDSR
  • Cloning and application of maize drought-resistant gene ZmDSR
  • Cloning and application of maize drought-resistant gene ZmDSR

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0033] Cloning of Example 1 ZmDSR Gene

[0034] According to the cDNA sequence of the ZmDSR gene (Gene ID: GRMZM2G122476) published by Gramene (http: / / www.gramene.org / ), use the online primer design software Primer-BLAST (https: / / www.ncbi.nlm.nih.gov / tools / primer-blast / index.cgi) design primer ZmDSR-Cloning, forward primer sequence: AGATCTTATGGCGCCGCCGGGGT, reverse primer sequence: CACGTGCTAGTAGTGGCAGCTCGTACCTAAC; then use the cDNA generated after reverse transcription of RNA extracted from material 082 as a template for amplification , the result of electrophoresis shows that the PCR product is about 250bp, such as figure 1 . The PCR product was connected to a cloning vector, and then sent to a sequencing company for sequencing. The results showed that the CDS of the gene was 234bp in length. The nucleotide sequence was shown in SEQ ID NO.1, encoding 77 amino acids as shown in SEQ ID NO.2.

Embodiment 2

[0035] Example 2 Detection of the expression level of ZmDSR under drought stress conditions

[0036] Sow the 082 seeds in the matrix until the seedlings grow to the 3-leaf stage, wash the root matrix with distilled water, and use filter paper to absorb the water in the roots; put the washed roots of the seedlings in 10% PEG-4000 hydroponic solution In the process, use an air pump to ventilate to increase the oxygen in the solution, and ventilate 3 to 4 times a day; after treatment for 0h, 1h, 6h, 12h, and 24h, samples are taken for subsequent RNA extraction and reverse transcription to generate cDNA templates.

[0037] Using the CDS sequence of the cloned ZmDSR gene, the online primer design software Primer-BLAST (https: / / www.ncbi.nlm.nih.gov / tools / primer-blast / index.cgi) was used to design quantitative primers for ZmDSR-qPCR amplification Maize seedlings were treated with PEG-4000, the forward primer sequence was: GGCGTACTTGGATTCTACGTCA, and the reverse primer: CTTTATCCTCCCGC...

Embodiment 3

[0038] Example 3 ZmDSR expression vector construction

[0039] The overexpression vector primer ZmDSR-Cloning with added BglII and PmlI restriction sites was used to amplify the ZmDSR CDS sequence, and after restriction digestion, it was connected to the binary vector pCAMBIA3301 (gifted by the National Maize Improvement Center). A fragment with a size of about 250bp was obtained, which met the expected goal, so the ZmDSR expression vector was constructed successfully, as shown in image 3 shown. ZmDSR is driven by the 35s promoter, and the pCAMBIA3301 vector has a selection marker gene bar in the T-DNA region, which encodes glufosinate acetyl CoA transferase (PAT), which can catalyze the free aminoacetylation of glufosinate, thereby Inactivates the herbicide glufosinate, see Figure 4 .

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses application of a maize drought-resistant gene ZmDSR in maize breeding, and the application is the application of the maize drought-resistant gene ZmDSR to the improvement on the drought stress tolerance of a maize variety. A protein encoded by the maize drought-resistant gene ZmDSR has an amino acid sequence shown in SEQ ID NO. 2. The maize drought-resistant gene ZmDSR hasa nucleotide sequence shown in SEQ ID NO. 1. The invention also provides a plant expression vector for improving the drought tolerance of maize, and a main active ingredient of the vector is the protein encoded by the maize drought-resistant gene ZmDSR, or an element expressing the protein, or an element expressing the maize drought-resistant gene ZmDSR. An overexpression vector of ZmDSR is constructed by amplifying the ZmDSR gene with a primer ZmDSR-Cloning to perform genetic transformation on arabidopsis thaliana. The overexpression of the gene in arabidopsis thaliana plants can significantly improve the drought tolerance of the plants, thereby providing a new way for cultivating new varieties of drought-tolerant maize.

Description

technical field [0001] The invention relates to the technical field of plant genetic engineering, in particular to the cloning and application of the corn drought resistance gene ZmDSR. Background technique [0002] Corn is an important food crop, feed crop and energy crop, and is the largest food crop in my country; corn plays an important role in my country's food security system. Corn has a large demand for water during the growth period, but 47% of my country's land area belongs to arid and semi-arid areas, and water resources are scarce (Wang Tao, Yang Baotong, A. Braeuning et al. Analysis of precipitation changes in arid and semi-arid areas in northern China in the past 0.5ka [J]. Science Bulletin, 2004,49(9):883-887); coupled with global climate warming in recent years, rainfall has decreased, which has exacerbated the situation of water resource shortage in arid and semi-arid areas in my country. Drought caused a substantial decline in corn production, and in severe ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N15/29C07K14/415C12N15/82A01H5/00A01H6/20
CPCC12N15/8273C07K14/415
Inventor 刘朝显蔡一林余婷婷王久光王国强周练
Owner SOUTHWEST UNIVERSITY
Features
  • Generate Ideas
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More