Method for preparing (R)-(4-chlorophenyl)oxirane from recombinant escherichia coli

A technology for recombining Escherichia coli and Escherichia coli, applied in the biological field, can solve the problems of harsh reaction conditions, weak stereoselectivity, toxicity and the like, and achieve the effect of strong enantioselectivity

Inactive Publication Date: 2019-04-19
JIANGNAN UNIV
View PDF7 Cites 2 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, the chemical synthesis method faces a series of problems such as dependence on heavy metal catalysts, toxicity, harsh reaction conditions, poor stereoselectivity and low yield.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Method for preparing (R)-(4-chlorophenyl)oxirane from recombinant escherichia coli
  • Method for preparing (R)-(4-chlorophenyl)oxirane from recombinant escherichia coli
  • Method for preparing (R)-(4-chlorophenyl)oxirane from recombinant escherichia coli

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0029] The cloning of embodiment 1 epoxide hydrolase gene and the construction of expression plasmid

[0030]The total RNA of tomato was extracted (using TRIZOL kit, Invitrogen Company), and the operation was performed according to the instructions of the kit. The reverse transcription process refers to the instructions of the RT-PCR kit (PCR PrimeScriptTM RT reagent Kit) from Takara Company, and then the cDNA obtained by reverse transcription is used as a template, and the upstream and downstream primers (the BamHI and XhoI restriction endonuclease enzymes are introduced into the primers) Cutting sites (synthesized by Shanghai Sangon)) sequences were GGATCCATGGAGAAGATAGAGCACAAGAT, CTCGAGGAACTTTTGAATGAAGTCATAGATGTG, and the full-length sleh1 gene was amplified by conventional PCR method. Extend at ℃ for 60s, cycle 30 times, and extend at 72℃ for 10min. The PCR product was detected by 1.0% agarose nucleic acid gel electrophoresis and after purification, the target fragment was...

Embodiment 2

[0031] Example 2 Effect of Temperature on Induced Expression of Recombinant Strain

[0032] Inoculate the genetically engineered bacteria E.coli / sleh1 in Example 1 in LB liquid medium containing 0.1g / L kanamycin, culture at 37°C and shake at 220rpm for 12h, then inoculate the culture solution at 1% Inject a large amount into LB medium, culture at 220 rpm at 37°C for 2.5 hours, then add IPTG at a concentration of 0.2 mM, culture at 220 rpm at 16-30°C for 8 hours, and collect the bacteria by centrifugation.

[0033] The obtained cells were treated with NaH according to the concentration of 150mg / mL wet cells 2 PO 4 -Na 2 HPO 4 (100mM, pH 7.5) buffer for resuspension. The bacterial suspension was directly used as a catalyst, and rac-pCSO was used as a substrate to compare the catalytic activity of living cells at different induction temperatures. The specific operation is: in a 10mL Ep plastic tube, add 3.3mL of bacterial suspension, 0.5mL of rac-pCSO methanol solution with ...

Embodiment 3

[0036] Embodiment 3 induction time influences the induced expression of recombinant strain

[0037] Inoculate the genetically engineered bacteria E.coli / sleh1 in Example 1 in LB liquid medium containing 0.1g / L kanamycin, culture at 37°C and shake at 220rpm for 12h, then inoculate the culture solution at 1% The amount was added to LB medium, shaken and cultured at 220 rpm at 37°C for 2.5h, then added with 0.2mM IPTG, shaken at 220rpm at 25°C for 4-16h, and collected by centrifugation.

[0038] The comparison method is the same as above, with the relative enzyme activity at the induction temperature of 8 hours as 100%, the catalytic activity of the living cells under different induction times is compared, and the results are shown in Table 2. The relative enzymatic activity of the epoxide hydrolase in the recombinant Escherichia coli cells after induction for 8-16 hours reaches over 80.1%.

[0039] Table 2

[0040]

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a method for preparing (R)-(4-chlorophenyl)oxirane from recombinant escherichia coli, and belongs to the technical field of biology. According to the method, tomato-derived epoxide hydrolase is expressed in escherichia coli, and a genetically engineered bacterium E.coli / sleh1 is constructed, and expression of the strain is used for preparing recombinant epoxide hydrolase. The invention provides a method for biological catalysis by using enzyme produced by fermenting the recombinant strain constructed in the method. (R)-(4-chlorophenyl)oxirane (ee is larger than 98%) ofenantiopure is prepared by catalyzing 150 mM racemized (4-chlorophenyl)oxirane; besides, the final yield reaches 47.5% and is close to the theoretical value of 50%.

Description

technical field [0001] The invention relates to a method for preparing (R)-p-chlorostyrene oxide by recombinant Escherichia coli, belonging to the field of biotechnology. Background technique [0002] Chiral epoxides and their vicinal diols are a class of multifunctional chiral compounds with high added value, which can be used in the synthesis of drugs, fine chemicals, pesticides and functional materials, and have important application value. For example, aromatic oxirane and its adjacent diols can be used as levamisole Levamisole, anti-HIV drug (-)-hyperolactone C, cardiovascular drug Nifenalol (R)-Nifenalol, anti-cancer drug Eliprodil and other synthetic precursors. At present, there are mainly two methods for the synthesis of chiral epoxides and their vicinal diols: chemical synthesis and biocatalysis. However, the chemical synthesis method faces a series of problems such as toxicity caused by heavy metal catalysts, harsh reaction conditions, poor stereoselectivity and...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N1/21C12P17/02C12P17/08C12R1/19
CPCC12N9/14C12P17/02C12P17/08C12Y303/02003
Inventor胡博淳苏永君章程徐雄峰李闯胡蝶李剑芳邬敏辰
OwnerJIANGNAN UNIV