Preparation method and application of CAR-T cell based on base editing target CD133

A technology of CD133-CAR and cd133-scfv, which is applied in the field of immunology and immunotherapy, can solve the problems of complex immune drug preparation process, high cost, and potential safety hazards, and achieve low off-target rate, high integration efficiency, and enhanced load capacity Effect

Inactive Publication Date: 2019-04-19
SUZHOU MAXIMUM BIO TECH CO LTD
View PDF3 Cites 3 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, CRISPR-Cas9-mediated gene editing has serious off-target effects, making it a certain safety hazard in clinical application
[0008] The preparation process of existing immune drugs is complex and expensive, so those skilled in the art are committed to developing technical solutions that can simplify and optimize the preparation process and reduce preparation costs

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Preparation method and application of CAR-T cell based on base editing target CD133
  • Preparation method and application of CAR-T cell based on base editing target CD133
  • Preparation method and application of CAR-T cell based on base editing target CD133

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0061] Example 1: Preparation of PBMC cells.

[0062] Take 15 mL of human peripheral blood, treat with anticoagulant (EATA or heparin), centrifuge at 350×g for 5 minutes at room temperature for 15 minutes, and aspirate the plasma for use.

[0063] Add 1 volume of PBS buffer to the blood cells to dilute and mix well, take a 15mL centrifuge tube, add 5 mL of lymphocyte separation medium Ficoll, and slowly add 5 mL of diluted blood cells to the upper layer. This step must be slow to prevent Ficoll from mixing with blood cells.

[0064] Slowly rise and fall, centrifuge at room temperature 450×g for 25 minutes, the blood cells are divided into platelet layer, white blood cell layer (buffy coat), polysucrose (Ficoll) layer and red blood cell layer from top to bottom, suck platelet layer (2mL), and white blood cell layer (Buffy coat, about 3 mL) was transferred to a new 15 mL centrifuge tube.

[0065] Add 10 mL of PBS buffer, centrifuge at 300*g for 10 minutes, discard the supernata...

Embodiment 2

[0066] Example 2: Codon optimization.

[0067] (1) Prepare the CD133 chimeric antigen receptor (CAR), namely CD133-CAR, and send the scFv fragment to the company for codon optimization to make it easier to express in human cells. The codon-optimized sequence is SEQ ID NO .1 the nucleotide sequence shown.

[0068] (2) Synthesize the target fragment, use In-Fusion technology to fuse the synthetic fragment to the PB-133CAR-puro vector, and make the PB-CD133-CAR-BBZ-puro plasmid (such as figure 2 shown), the DNA sequence is the nucleotide sequence shown in SEQ ID NO.2.

[0069] Synthetic primers Primer-F: CGGCGCCTACTCTAGATGCTGCTGCTGGTGACCCTCTCTGC and Primer-R: GGGGACGAACAGATCAGATCCGGCTGCAGCGGC. The synthesized CD133 optimized sequence was amplified by PCR, and the CD133 PCR product was recovered.

[0070] The original PB-CD19 CAR-puro vector was double-digested with Xba I and Bgl II restriction endonucleases, followed by the steps of the TaKaRaIn-Fusion kit, the templates were...

Embodiment 3

[0072] Example 3: Using the BE-Plus system to prepare CAR-T cells targeting CD133 and knocking out the PD-1 gene

[0073]Based on the efficiency of BE-Plus-mediated single base editing, design a gene knockout strategy: introduce stop codons through CT mutations, such as mutating CAA, CAG, and CGA into stop codons TAA, TAG, and TGA, to stop coding Gene translation, thereby achieving gene knockout. Or reverse CT mutation, the CCA codon is mutated to TCA, CTA, and its reverse complementary codon TGG is mutated to TGA, TAG, BE-Plus dual plasmid system (pST1374-scfv-APOBEC-UGI-GB1 (such as image 3 shown), pST1374-N-NLS-GCN4-D10A (as shown Figure 4 As shown)), 10 GCN4s were connected to the N-terminal of D10A, and one scFv was connected to the N-terminal of APOBEC. In this way, GCN4-D10A can recruit 10 scFv-APOBECs, increasing the probability of mutation. The work window is expanded from 4-8 to 4-16, making the efficiency higher.

[0074] Select the 20bp-NGG target sequence (P...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a preparation method and application of a CAR-T cell based on PD-1 gene knock-out and base editing target CD133. The method comprises the steps that gene knocking out is conducted through a BE-Plus system while a plasmid vector expressing a leukocyte differentiation antigen CD133-CAR is guided into a T cell, and the obtained CAR-T cell can be applied to the preparation of anti-tumor drugs. The method has the advantages that the preparation technology is simple, and the method has higher application value in treating tumor cells.

Description

technical field [0001] The present invention relates to the field of immunology, in particular to the field of immunotherapy, in particular to a preparation method and application of T cells knocking out the PD-1 gene and expressing CD133-CAR. Background technique [0002] CD133 is a cell surface antigen marker, a member of the prominin family, also known as prominin-1, which is a glycoprotein encoded by the PROM1 gene in humans. It is a member of the transmembrane protein, specifically localized in cell protrusions. When embedded in the cell membrane, the membrane topology of prominin-1 in the cell membrane extends the N-terminus into the extracellular space and the C-terminus in the intracellular compartment. CD133 in hematopoietic stem cells, endothelial progenitor cells, glioblastoma, neurons and glial stem cells, various pediatric brain tumors, and adult kidney, breast, trachea, salivary gland, uterus, placenta, digestive tract, testis and other cell types Express. I...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N5/10C12N15/113C12N15/85A61K35/17A61P35/00
CPCA61P35/00A61K35/17C12N5/0636C12N15/113C12N15/85C07K14/7051C07K14/70521C07K16/2896C12N2310/10C12N2510/00C12N2501/515C12N2800/22C07K2319/33C07K2317/622
Inventor尚小云蒋海娟刘慧莹马少文沈慧张锋赵丹
OwnerSUZHOU MAXIMUM BIO TECH CO LTD