Application of Coryneform Bacteria Gene jny31014 in Improving L-Lysine Production
A technology of coryneform bacteria and lysine, applied in the biological field, can solve the problems of low sugar consumption rate, slow growth rate, poor tolerance, etc., and achieve the effects of increasing yield, reducing transport rate, and reducing production costs
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0038] Example 1: Construction of gene knockout fragments
[0039]1) (i) extracting Corynebacterium glutamicum 23604 genomic DNA as a template, performing PCR amplification to obtain about 500bp fragment NCg2 in the JNy31014 gene;
[0040] Described PCR primer sequence is as follows:
[0041] F1: CGCGAATTCCACTTATCAGCCTCAACACTCC
[0042] R1: AGGCCAGCAAAAGTTTCTTATGCAACGCCCACC
[0043] Described PCR amplification system is:
[0044]
[0045] The PCR amplification procedure is as follows:
[0046] Pre-denaturation at 95°C for 5 min; denaturation at 94°C for 30 sec, annealing at 55°C for 30 sec, extension at 72°C for 30 sec, 30 cycles; extension at 72°C for 10 min, storage at 4°C;
[0047] The PCR product was checked by agarose gel electrophoresis, the length was about 550bp, and the gel was recovered using the SanPrep Column DNA Gel Recovery Kit (Shanghai Sangong), and the recovered product was stored at -20°C for later use;
[0048] (ii) Extract the DNA of the shuttle pla...
Embodiment 2
[0065] Embodiment 2: preparation coryneform bacterium competent state
[0066] (i) pick a single colony of Corynebacterium glutamicum (Corynebacterium glutamicum) 23604 on the surface of fresh LBG solid medium, inoculate in 10mL LBG medium, cultivate overnight at 30°C and 200r / min;
[0067] (ii) Take 1mL of the above bacterial solution and transfer it to 100mL EPO liquid medium, and cultivate it to OD at 37°C and 220r / min 600 =0.9;
[0068] (iii) Transfer the bacterial solution to a 100mL centrifuge tube, and place it in an ice bath for 15-20 minutes to stop the growth of the bacterial cells;
[0069] (iv) Centrifuge at 4°C, 5000g, 5min after ice bath, and collect the bacteria;
[0070] (v) The centrifuged thalline was washed 2-3 times with pre-cooled electroporation buffer (LBHIS);
[0071] (vi) After washing, use 1000uL electroporation buffer to resuspend the bacteria;
[0072] (vii) Aliquot the prepared competent cells into 100 μL tubes and store at -80°C for later use....
Embodiment 3
[0075] Example 3: NCg2-Cm r Fragment electrotransformation of Corynebacterium glutamicum 23604
[0076] (i) the NCg2-Cm r The fragment was digested with the restriction endonuclease EcoRI;
[0077] Enzyme digestion system (40μL) is as follows:
[0078]
[0079] (ii) Concentrate and purify the digested product
[0080] (1) Add 1 / 10 volume of 3M sodium acetate and 2.5 volumes of absolute ethanol, and place in a -20°C refrigerator for 20 minutes;
[0081] (2) Centrifuge at 12000r / min for 5min to obtain a precipitate;
[0082] (3) 300 μL of 75% ethanol to resuspend the pellet;
[0083] (4) Centrifuge at 12000r / min for 5min, remove ethanol, and air-dry at 37°C for 30min;
[0084] (5) Add 15-18μL ddH 2 O Resuspend DNA and store at -20°C.
[0085] (iii) Electroconversion
[0086] Firstly, NCg2-Cm was measured by nucleic acid ultramicro spectrophotometer r Fragment concentration, after reaching a suitable concentration, perform electrotransformation, take 100 μL of the re...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More