Fluorescent quantitative test strip for porcine epidemic diarrhea virus, and preparation method and application thereof
A fluorescence quantitative detection, porcine epidemic diarrhea technology, applied in the direction of measuring devices, instruments, scientific instruments, etc., can solve the problems of piglet death, economic losses in the pig industry, and high prices, to avoid subjectivity deviation, and to achieve good clinical application value. Effect
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0042] Embodiment 1 Preparation of anti-PEDV N protein monoclonal antibody
[0043] 1 method
[0044] 1.1 Amplification of PEDV N gene and construction of recombinant plasmid
[0045] Viral RNA was extracted according to the instructions of the viral genome RNA extraction kit (RNeasy Mini Kit, QIAGEN). After the RNA was synthesized into cDNA by reverse transcription, specific primers (PEDV-N-F1 :CTG GGATCC ATGGCTTCTGTCAGTTTTTCAG; PEDV-N-R1326:CCG CTCGAG TTAATTTCCTGTGTCGAAG) amplifies the PEDV N gene. The PCR reaction conditions were pre-denaturation at 98°C for 30s, followed by 30 cycles of amplification at 98°C for 10s, 60°C for 30s, 68°C for 1min, and extension at 68°C for 7min. After the PCR product was identified by nucleic acid gel electrophoresis, the PCR product and pGEX-6p-1 empty vector were cut with BamH I and Xho I restriction endonucleases, and the target gene was obtained by gel recovery, and the obtained target gene was processed by T4DNA ligase (NEB ) con...
Embodiment 2
[0068] The assembly of embodiment 2 test strips and its application in detecting PEDV
[0069] 1 method
[0070] 1.1 Preparation of PEDV antibody fluorescent microsphere markers
[0071] Take 100 μL of Eu fluorescent microspheres with a solid content of 1% (Nanjing Weicei Biotechnology Co., Ltd.) and dilute it in 400 μL of 0.05 mol / L borate buffer solution with pH 8.0, and add 30 μL of 10 mg / mL carbodiimide (EDC) (purchased from Shanghai Crystal Pure Biochemical Technology Co., Ltd.) and 60 μL of 10 mg / mL N-hydroxysuccinimide (NHS) (purchased from Shanghai Crystal Pure Biochemical Technology Co., Ltd.), placed on a rotary shaker at room temperature at 50 rpm After activation for 15 minutes, centrifuge at 40,000g for 10 minutes, remove the supernatant solution, redissolve with 0.05mol / L borate buffer at pH 8.0, then ultrasonicate at 80W for 30s, and add 50 μg of PEDV monoclonal antibody 15B12 (preserved by CGMCC NO. 16299 hybridoma cells), placed on a rotary shaker at room te...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More - R&D
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com



