LAMP primers for detecting EB viruses in intraocular fluid and application thereof

An Epstein-Barr virus and primer set technology, applied in the biological field, can solve problems such as easy contamination, application limitations, and high false positive rate, and achieve high specificity, high sensitivity, and accurate detection effects

Inactive Publication Date: 2019-10-01
BEIJING CHAOYANG HOSPITAL CAPITAL MEDICAL UNIV
View PDF1 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, PCR has the disadvantages of long detection time, easy contamination, and high false positive rate, which limits its application.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • LAMP primers for detecting EB viruses in intraocular fluid and application thereof
  • LAMP primers for detecting EB viruses in intraocular fluid and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0070] Embodiment 1, the preparation of the primer set identifying Epstein-Barr virus

[0071] A large number of sequence analyzes and comparisons were carried out to obtain several primers for identifying Epstein-Barr virus. Preliminary experiments were performed on each primer to compare performances such as sensitivity and specificity, and finally a LAMP primer set for identifying Epstein-Barr virus was obtained.

[0072] A primer set for identifying Epstein-Barr virus, including 2 outer primers (F3-1, B3-1), 2 inner primers (FIP-1, BIP-1) and 2 loop primers (LF-1, LB-1 ), each primer sequence is as follows (5'→3'):

[0073] Primer F3-1 (sequence 1 of the sequence listing): GTTCGCGTTGCTAGGCC;

[0074] Primer B3-1 (sequence 2 of the sequence listing): AAGGGGAAAAGTTAGAAACTG;

[0075] Primer FIP-1 (Sequence 3 of the Sequence Listing): ATACCAGGGGCAGTGGTCCCTCTCAGTCCAGCGCGTTTA;

[0076] Primer BIP-1 (SEQ ID NO: 4 of the Sequence Listing): GTCCTGCAGCTATTTCTGGTCGCTAGGGAGAGGTAGA...

Embodiment 2

[0080] Embodiment 2, detection method establishment

[0081] Utilize the method for the primer group detection Epstein-Barr virus of identifying Epstein-Barr virus of embodiment 1 to comprise:

[0082] 1. Extract the genomic DNA of the virus to be tested or extract the total DNA of the biological sample to be tested.

[0083] 2. Take the total DNA obtained in step 1 as a template, and use the primer set prepared in Example 1 to perform LAMP amplification.

[0084] The reaction system for 10μL LAMP amplification includes: 1μL 10×ThermoPol Buffer (Thermo), 0.8M Betaine, 0.5mg / ml BSA, 4mM MgSO 4 , 0.3μL 20×EvaGreen (Hefei Bomei Biotechnology Co., Ltd.), 1.5mM dNTPs, 0.32U / ml Bst DNA polymerase large fragment, primer mix (F3-1, B3-1, FIP-1, BIP-1, LF-1 and LB-1 mixture), 2ng template DNA, balance ddH 2 O. The concentration of each primer in the reaction system is as follows: 0.5 μM F3-1, 0.5 μM B3-1, 2 μM FIP-1, 2 μM BIP-1, 1 μM LF-1, 1 μM LB-1.

[0085] Reaction program for ...

Embodiment 3

[0088] Embodiment 3, identify the specificity of the primer group of Epstein-Barr virus

[0089] Epstein-Barr virus reference plasmid construction: insert the Epstein-Barr virus DNA fragment shown in Sequence 7 of the sequence listing between the ApaI and SacI restriction sites of the pGEM-TEasy Vector vector to obtain the reference plasmid.

[0090] The samples to be tested were: Epstein-Barr virus reference plasmid DNA, herpes simplex virus type I genomic DNA, herpes simplex virus type II genomic DNA, varicella-zoster virus genomic DNA, and cytomegalovirus genomic DNA. Among them, herpes simplex virus type Ⅰ, herpes simplex virus type Ⅱ, varicella-zoster virus and cytomegalovirus reference plasmid DNA are all recorded in the literature "Zhu Yanmin, Wu Yidong, Shang Shiqiang. Gene chip method for detection of seven herpes viruses and its preliminary application [J]. Journal of Clinical Laboratory, 2009 (5): 363-365.", the genomic DNA of each virus was extracted, and the sampl...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a set of LAMP primers for detecting EB viruses in an intraocular fluid and application thereof. The LAMP primers are composed of six single-stranded DNA molecules shown in sequences 1-6. The invention further discloses the application of the LAMP primers and a kit containing the LAMP primers. Experiments show that the LAMP primers have high specificity and high sensitivitywhen used for detecting the EB viruses, and the applied LAMP primers and method can rapidly and accurately detect the EB viruses.

Description

technical field [0001] The invention relates to a group of LAMP primers for detecting Epstein-Barr virus in intraocular fluid and its application in the field of biotechnology. Background technique [0002] Epstein-Barr virus (EBV), also known as human herpesvirus 4 (Human herpesvirus 4, HHV-4), is a DNA pathogenic virus of the gamma subfamily Lymphotropic virus genus, which has specific in vivo and in vitro The biological characteristics of monotropic infection of human and some primate B cells. It is mainly transmitted through saliva, and asymptomatic infection mostly occurs in young children. More than 90% of children aged 3 to 5 have been infected with Epstein-Barr virus, and more than 90% of adults have virus antibodies in their bodies. With the widespread use of antibiotics and hormone drugs, viral intraocular inflammation is becoming more and more common in ophthalmology clinics, and has become one of the main blinding eye diseases. [0003] The current clinical det...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N15/11C12Q1/70
CPCC12Q1/705C12Q1/6844
Inventor陶勇
OwnerBEIJING CHAOYANG HOSPITAL CAPITAL MEDICAL UNIV