Three internal reference genes of acipenser dabryanus, primer development and stability evaluation technique

An internal reference gene, Dabry's sturgeon technology, applied in the field of molecular biology, can solve problems such as the lack of internal reference genes in Dabry's sturgeon, and achieve the effects of improving reliability and repeatability, improving detection efficiency, and improving credibility

Inactive Publication Date: 2019-10-01
SICHUAN AGRI UNIV
View PDF3 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0005] The technical problem to be solved in the present invention is to overcome the lack of internal reference genes in the existing Dabry's sturgeon, and provide an accurate and efficient eukaryotic gene identification method based on transcriptome, so as to solve the above problems

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Three internal reference genes of acipenser dabryanus, primer development and stability evaluation technique
  • Three internal reference genes of acipenser dabryanus, primer development and stability evaluation technique
  • Three internal reference genes of acipenser dabryanus, primer development and stability evaluation technique

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0054] Example 1 Cloning of ACT, GAPDH and EF1-α genes of Dabry's sturgeon

[0055] 1) Design of primers for ACT, GAPDH and EF1-α genes

[0056] The ACT, GAPDH and EF1-α genes were cloned by homologous cloning method, searched the NCBI database and constructed the local Blast database, searched for the homologous sequences of the corresponding genes, and designed RT-PCR primers in the conserved regions of the homologous sequences. The partial sequence of the gene and the ACT gene of Acipenser dabryi were used to design primers for the ACT gene of Acipenser dabryi, and the GAPDH of Acipenser dabryi. Two sequences GETX01028036.1 and GEUL01069530.1 from Acipenser dabryii, Siberian sturgeon and local database were used to design primers for the EF1-α gene of Acipenser dabryi;

[0057] 2) Extraction of total RNA from the liver of Acipenser dabryi

[0058] Take about 100mg of liver tissue and place it in a 1.5ml EP tube pre-added with 100μl Buffer Rlysis-AG lysate. After fully gri...

Embodiment 2

[0065] Example 2 Real-time fluorescent quantitative PCR primer design and primer quality detection

[0066] 1) Based on the nucleotide sequences of ACT, GAPDH and EF1-α obtained in Example 1, the fluorescent quantitative specific primers were designed according to the principles of real-time fluorescent quantitative PCR primer design, and the lengths of the amplified fragments were 203bp, 115bp and 171bp respectively , the fluorescent quantitative specific primers are the real-time fluorescent quantitative PCR primers, respectively

[0067] qACT-F CTGTTTCAGCCATCCTTCTTG

[0068] qACT-R TTGATTTTCATTGTGCTCGGT

[0069] qGAPDH-F TCAAATGGGGTGATGCTGGAG

[0070] qGAPDH-R GCGGAGATGATGACACGCTTAG

[0071] qEF1-α-F GAAAGGAAAAGACCCACAT

[0072] qEF1-α-R CCAGGCATACTTGAAGGAGC

[0073] 2) Extract the total RNA of Sturgeon dabryi's brain, and synthesize the first strand of cDNA according to the method of the PrimeScriptTM 1st Strand cDNA Synthesis Kit kit, that is, reverse transcribe the ...

Embodiment 3A

[0076] Tissue expression stability analysis of embodiment 3 ACT, GAPDH and EF1-α

[0077] 1) Tissue sampling

[0078] A 350±10g sample of three-tailed Dabry's sturgeon was collected at the Yibin Artificial Breeding Base of the Fisheries Research Institute of the Sichuan Academy of Agricultural Sciences. The Dabry's sturgeon was quickly dissected in a biological safety cabinet, and the brain, liver, kidney, pancreas, spleen, esophagus, stomach, and pylorus were removed. The caecum, duodenum, valve intestine, rectum, muscle, gills, and skin were quickly washed with ice-bathed saline to remove blood stains, and the processed liver was packed in a sample tube, which was quickly frozen in liquid nitrogen and stored at -80°C. ℃ refrigerator;

[0079] 2) RNA extraction

[0080] Take about 100mg of preserved tissue and place it in a 1.5ml EP tube pre-added with 100μl Buffer Rlysis-AG lysate. After fully grinding with an electric grinder, add 350μl of Buffer Rlysis-AG, and then refer...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses an accurate and highly efficient transcriptome-based eukaryotic gene identification method. The method includes the following steps that three internal reference genes of acipenser dabryanus are obtained through PCR amplification reaction of a high-fidelity enzyme, real-time fluorescence quantitative primers of the three internal reference genes of the acipenser dabryanus are developed, the quality of the primers of the three internal reference genes of the acipenser dabryanus are evaluated based on a standard curve and a melting curve, and the stability of the three internal reference genes of the acipenser dabryanus in tissue expression is evaluated. According to the accurate and highly efficient transcriptome-based eukaryotic gene identification method, by providing full-length coding regions of the three internal reference genes (ACT, GAPDH and EF1-alpha genes), more internal reference gene choices are provided for fluorescence quantitative research of the acipenser dabryanus; by developing the fluorescence quantitative primers based on nucleotide sequences of ACT, GAPDH and EF1-alpha, the reliability and reproducibility of fluorescence quantitative research are greatly improved; the stability of ACT, GAPDH and EF1-alpha in tissue expression is evaluated, and stable and suitable internal reference genes are provided for the fluorescence quantitativeresearch of the acipenser dabryanus.

Description

[0001] The invention relates to an accurate and efficient eukaryotic gene identification method based on transcriptome, and relates to the technical field of molecular biology. Background technique [0002] Dabry's sturgeon is mainly distributed in the main and tributaries of the Yangtze River and large lakes along the river. It is a national first-class protected animal. It is listed in the "Convention on International Trade in Endangered Species". It is an important ecological protection species and a great potential sturgeon industry resource. In 2013, the artificial propagation technology of Dabry's sturgeon was conquered. At present, some studies on the development and nutrition of Acipenser dabryi have been carried out, but the research on the molecular level is still in its infancy. [0003] Real-time fluorescent quantitative PCR (qPCR) is a common technique in molecular research. The internal reference gene in qPCR can correct the influence of various factors such as ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityApplications(China)
IPC IPC(8): C12Q1/6888C12Q1/6851C12N15/11
CPCC12Q1/6888C12Q1/6851C12Q2600/166C12Q2531/113C12Q2545/101C12Q2563/107
Inventor李志琼陈虎汪斌周波唐妮齐锦雯陈德芳王书瑶吴源冰田正志王美徐少奇
OwnerSICHUAN AGRI UNIV