Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Primer and probe combination for human apolipoprotein E (ApoE) gene typing, and using method of primer and probe combination

A primer probe and genotyping technology, applied in the field of genes, can solve the problems of missed and wrongly detected primer probe design, complex detection results judgment, multiple amplification primers, etc., to enhance sensitivity and specificity, and result interpretation. Simple and clear, the effect of reducing the cost of use

Inactive Publication Date: 2019-11-26
SUZHOU RES INST OF TONGJI UNIV
View PDF2 Cites 2 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0006] Existing PCR detection methods for genotyping point mutations still have some common problems when detecting complex samples: 1) The error rate is high, and under the background of a large number of wild-type genes, primers are prone to mismatch and missed detection and false detection 2) The design of primers and probes is complicated or requires multiple amplification primers, which is costly; 3) The detection result is complicated to judge, and the △Ct value needs to be calculated or combined with melting curve analysis

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Primer and probe combination for human apolipoprotein E (ApoE) gene typing, and using method of primer and probe combination
  • Primer and probe combination for human apolipoprotein E (ApoE) gene typing, and using method of primer and probe combination
  • Primer and probe combination for human apolipoprotein E (ApoE) gene typing, and using method of primer and probe combination

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0059] Embodiment 1.ApoE genotyping primer probe design

[0060] 1) ApoE gene sequence

[0061] The human ApoE gene is located on chromosome 19 of the genome. For the genomic DNA sequence of the ApoE gene, see NC_000019.10:44905749-44909395. The full-length cDNA sequence (Genebank NM_001302688.1) encoding the wild-type ApoE3 gene is shown in SEQ ID No:1.

[0062] SEQ ID No: 1

[0063]GGGACAGGGGGAGCCCTATAATTGGACAAGTCTGGGATCCTTGAGTCCTACTCAGCCCCAGCGGAGGTGAAGGACGTCCTTCCCCAGGAGCCGGTGAGAAGCGCAGTCGGGGGCACGGGGATGAGCTCAGGGGCCTCTAGAAAGAGCTGGGACCCTGGGAACCCCTGGCCTCCAGACTGGCCAATCACAGGCAGGAAGATGAAGGTTCTGTGGGCTGCGTTGCTGGTCACATTCCTGGCAGGATGCCAGGCCAAGGTGGAGCAAGCGGTGGAGACAGAGCCGGAGCCCGAGCTGCGCCAGCAGACCGAGTGGCAGAGCGGCCAGCGCTGGGAACTGGCACTGGGTCGCTTTTGGGATTACCTGCGCTGGGTGCAGACACTGTCTGAGCAGGTGCAGGAGGAGCTGCTCAGCTCCCAGGTCACCCAGGAACTGAGGGCGCTGATGGACGAGACCATGAAGGAGTTGAAGGCCTACAAATCGGAACTGGAGGAACAACTGACCCCGGTGGCGGAGGAGACGCGGGCACGGCTGTCCAAGGAGCTGCAGGCGGCGCAGGCCCGGCTGGGCGCGGACATGGAGGACGTGTGCGGCCGCCTGGTGCAG...

Embodiment 2

[0087] Embodiment 2. Application of ApoE genotyping reagent to the typing detection of samples

[0088] (1) Test samples: The test samples are DNA samples from the blood of healthy people.

[0089] Blood DNA samples were extracted using Tiangen Blood Genomic DNA Extraction Kit, and 0.5ml of blood was taken from each sample, and extracted according to the requirements of the kit instructions.

[0090] The concentration of the nucleic acid sample was measured with an Eppendorf ultraviolet spectrophotometer to control the quality of DNA extraction OD260 / 280≧1.8.

[0091] (2) Reaction system

[0092] The reaction system includes 1×Premix Taq™ Hot Start (TakaraBio Inc, R028A) for each assay reaction mixture (25 μl). Two independent reaction systems are used to detect two possible point mutation types of ApoE2 and ApoE4 respectively. The two reaction systems The reaction components and their concentrations are shown in Table 6 and Table 7.

[0093] Table 6. ApoE2 typing reagent c...

Embodiment 3

[0106] Example 3. Comparison of ApoE genotyping detection and sequencing results

[0107] In this example, ApoE genotyping was detected in blood gDNA samples of 8 healthy volunteers by using the primer-probe combination reagent and the sequencing method of the present invention respectively. The DNA extraction method of the blood sample was as described above. Refer to Example 2 for the method of using the detection reagent. The test results of the 8 samples are shown in Table 10. and sequencing test results (see figure 1 ) consistent, indicating that the ApoE typing reagent of the present invention has higher detection accuracy.

[0108] Table 10. ApoE genotype detection of 8 healthy people

[0109]

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention belongs to the technical field of genes, and provides a primer and probe combination for human apolipoprotein E (ApoE) gene typing, and a using method of the primer and probe combination. An allele specific primer is designed for an ApoE gene point mutation gene sequence, a closed primer is designed for a wild-type sequence, a mutation-rich amplification reaction condition is adopted, and thus ApoE genes can be subjected to typing detection. The method has the characteristics of being quick in detection, easy and convenient to operate, high in sensitivity, high in specificity andlow in cost, result interpretation is easy and clear, the sample gene type is judged only according to the Ct value, the primer and probe combination and the using method thereof can be widely used for ApoE typing detection of various DNA samples of humans, and research work of the relation between ApoE gene polymorphism and related diseases is facilitated.

Description

technical field [0001] The invention belongs to the field of gene technology, and relates to a combination of primers and probes for ApoE genotyping, a kit and a use method thereof. Background technique [0002] Apolipoprotein E (Apolipoprotein E, ApoE) gene is located on the 13th region 2 band (19q132) of the long arm of human chromosome 19. It contains 4 exons and 3 introns, with a total length of 3.7kb. Apolipoprotein E is a basic protein rich in arginine and a multifunctional glycoprotein. ApoE protein participates in the transportation, storage and excretion of lipids, and also participates in the development of the nervous system and repair after injury. Both the high incidence of atherosclerosis and Alzheimer's disease in humans are related to the abnormal regulation of lipid metabolism involved in ApoE protein. Studies have shown that polymorphisms of the ApoE gene are associated with the occurrence of coronary heart disease, hyperlipidemia, and cerebral infarction....

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12Q1/6883C12Q1/6858C12N15/11
CPCC12Q1/6858C12Q1/6883C12Q2600/156C12Q2600/166C12Q2531/113C12Q2561/101C12Q2527/101
Inventor 孙慧滕飞蒋明于丽华房健民
Owner SUZHOU RES INST OF TONGJI UNIV
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com