Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Primer, probe and kit for detecting canine distemper virus of giant panda

A technology of canine distemper virus and giant panda, applied in biochemical equipment and methods, measurement/testing of microorganisms, and resistance to vector-borne diseases, etc., can solve the threat of giant panda population, affect the specificity of product detection, and aerosol pollution To achieve stable and reliable detection results, improve detection specificity, and high compliance

Pending Publication Date: 2020-01-17
ACAD OF MILITARY SCI PLA CHINA ACAD OF MILITARY MEDICAL SCI INST OF MILITARY VETERINARY MEDICINE +1
View PDF8 Cites 2 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

From December 2014 to April 2015, canine distemper broke out in 22 captive giant pandas in the Shaanxi Rare Wildlife Rescue and Breeding Research Center. Six of them tested positive for CDV nucleic acid, and 5 of them died after rescue failed. poses a great threat to the entire giant panda population
However, the traditional RPA is prone to aerosol pollution, which often affects the specificity of product detection in practice, and the closed nucleic acid detection device in which the amplified product is transferred to the chromatographic test strip provides a closed environment for the detection process of the nucleic acid amplification product , thereby reducing the risk of nucleic acid aerosol contamination

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Primer, probe and kit for detecting canine distemper virus of giant panda
  • Primer, probe and kit for detecting canine distemper virus of giant panda
  • Primer, probe and kit for detecting canine distemper virus of giant panda

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0029] This embodiment provides a primer and a probe for the detection of canine distemper virus in giant pandas. The primers are designed using the giant panda / SX / 2014 strain of canine distemper virus derived from giant pandas (Genbank: KP793921) as a template;

[0030] The upstream primer F of the primer is shown in SEQ ID NO: 1:

[0031] 5'-[Biotin]AACGGAGGACCGGACGATTCGCACTGCTGG-3';

[0032] The downstream primer R of the primer is shown in SEQ ID NO:2:

[0033] 5'-CATCATTGAAGTGGATGGGGTATTTGTCTC-3';

[0034] Shown in the probe SEQ ID NO:3 corresponding to the primer:

[0035] 5'-[FITC]CTCTTGTTGATGGTTGGGGGTTGTTGATTGGT(THF)GACTTCGGATCTTTC[C3-Spacer]-3'.

Embodiment 2

[0037] This embodiment provides a kit with the primers and probes described in Embodiment 1.

[0038] Further, the kit also includes RNA standard positive products as shown in SEQ ID NO: 4:

[0039] 5’-GGCAUCACCAAGGAAGAGGCUCAGCUAGUGUCAGAAAUAGCAUCCAAGACAACGGAGGACCGGACGAUUCGCACUGCUGGUCCCAAGCAAUCUCAAAUCACUUUUCUGCACUCAGAAAGAUCCGAAGUCACCAAUCAACAACCCCCAACCAUCAACAAGAGGUCCGAAAACCAAGGAGGAGACAAAUACCCCAUCCACUUCAAUGAUGAACGAUUUUCAGGGUACACCCCUGAUGUCAACAGCUCCGAAUGGAGUGAA-3’。

[0040] Further, the kit also includes a universal nucleic acid detection test strip.

[0041] Further, the kit also contains a fully enclosed nucleic acid rapid detection device. Preferably, the fully enclosed nucleic acid rapid detection device is a product of Hangzhou Ustar Biotechnology Co., Ltd., and the universal nucleic acid detection test strip is placed in a palm-held plastic device.

[0042] Further, the kit also includes recombinase, polymerase, hydrolysis buffer, magnesium acetate fusion and RNaseFree ddH 2...

Embodiment 3

[0045] The present embodiment provides a rapid on-site detection method for canine distemper using the kit described in Embodiment 1, which is a visual on-site rapid detection method, which includes the following steps:

[0046] (1) viral RNA or RNA positive standard, with described primer, probe, reverse transcriptase, RNase inhibitor, resuspension buffer and ddH 2 O mix well, add in the reaction tube that recombinase, polymerase and hydrolysis buffer are housed, then add magnesium acetate solution, centrifuge briefly after fully mixing;

[0047] (2) constant temperature amplification reaction;

[0048] (3) The amplification reaction product is detected using a fully enclosed nucleic acid rapid detection device;

[0049] (4) Interpretation of the results, if there is a red band at the position of the quality control line and the detection line by visual observation, then the sample contains canine distemper virus; The sample does not contain canine distemper virus; if there...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

PropertyMeasurementUnit
Sensitivityaaaaaaaaaa
Login to View More

Abstract

The invention discloses a primer, a probe and a kit for detecting canine distemper virus of a giant panda. Based on the design of the primer and the probe, the canine distemper virus of the giant panda (giant panda / SX / 2014 strain) (Genbank:KP793921) is used as a template, the detection specificity is improved, and cross reaction between the canine distemper virus of the giant panda and other viruses such as canine parvovirus (CPV), canine coronavirus (CCV), canine parainfluenza virus (CPIV) and canine rotavirus (CRV) is avoided; when the primer and the probe are applied to detection of the canine distemper virus of the giant panda, the sensitivity is high, a detection limit is 5x101copy / microliters, and a detection result is reliable; and compared with an existing RT-PCR method, the primerand the probe are very high in conformity, and can realize portable quick diagnosis on site.

Description

technical field [0001] The invention relates to the field of biotechnology, in particular to a primer, a probe and a kit for detecting canine distemper virus by applying recombinase polymerase isothermal amplification technology (Recombinase Polymerase Amplification, RPA) combined with nucleic acid detection test strips. Background technique [0002] Canine distemper (CD) is an acute and highly contagious disease of dogs and other carnivorous animals caused by canine distemper virus (CDV) infection. Canine distemper was initially described as an infectious disease of dogs. With the continuous evolution and cross-species transmission of the virus, the host range of CDV has continued to expand in recent years, and has expanded from the traditional canine, raccoon and mustelidae to cats. , Civets and all terrestrial carnivores and non-human primates. Since it was first reported in 1809, the disease has become a worldwide epidemic, seriously affecting companion, commercial and ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12Q1/70C12Q1/6844C12N15/11
CPCC12Q1/701C12Q1/6844C12Q2600/166C12Q2521/507C12Q2531/119C12Q2537/1376C12Q2565/625Y02A50/30
Inventor 冯娜高玉伟王建忠黄培王铁成赵永坤杨松涛夏咸柱
Owner ACAD OF MILITARY SCI PLA CHINA ACAD OF MILITARY MEDICAL SCI INST OF MILITARY VETERINARY MEDICINE
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com