Primer, probe and kit for detecting canine distemper virus of giant panda
A technology of canine distemper virus and giant panda, applied in biochemical equipment and methods, measurement/testing of microorganisms, and resistance to vector-borne diseases, etc., can solve the threat of giant panda population, affect the specificity of product detection, and aerosol pollution To achieve stable and reliable detection results, improve detection specificity, and high compliance
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0029] This embodiment provides a primer and a probe for the detection of canine distemper virus in giant pandas. The primers are designed using the giant panda / SX / 2014 strain of canine distemper virus derived from giant pandas (Genbank: KP793921) as a template;
[0030] The upstream primer F of the primer is shown in SEQ ID NO: 1:
[0031] 5'-[Biotin]AACGGAGGACCGGACGATTCGCACTGCTGG-3';
[0032] The downstream primer R of the primer is shown in SEQ ID NO:2:
[0033] 5'-CATCATTGAAGTGGATGGGGTATTTGTCTC-3';
[0034] Shown in the probe SEQ ID NO:3 corresponding to the primer:
[0035] 5'-[FITC]CTCTTGTTGATGGTTGGGGGTTGTTGATTGGT(THF)GACTTCGGATCTTTC[C3-Spacer]-3'.
Embodiment 2
[0037] This embodiment provides a kit with the primers and probes described in Embodiment 1.
[0038] Further, the kit also includes RNA standard positive products as shown in SEQ ID NO: 4:
[0039] 5’-GGCAUCACCAAGGAAGAGGCUCAGCUAGUGUCAGAAAUAGCAUCCAAGACAACGGAGGACCGGACGAUUCGCACUGCUGGUCCCAAGCAAUCUCAAAUCACUUUUCUGCACUCAGAAAGAUCCGAAGUCACCAAUCAACAACCCCCAACCAUCAACAAGAGGUCCGAAAACCAAGGAGGAGACAAAUACCCCAUCCACUUCAAUGAUGAACGAUUUUCAGGGUACACCCCUGAUGUCAACAGCUCCGAAUGGAGUGAA-3’。
[0040] Further, the kit also includes a universal nucleic acid detection test strip.
[0041] Further, the kit also contains a fully enclosed nucleic acid rapid detection device. Preferably, the fully enclosed nucleic acid rapid detection device is a product of Hangzhou Ustar Biotechnology Co., Ltd., and the universal nucleic acid detection test strip is placed in a palm-held plastic device.
[0042] Further, the kit also includes recombinase, polymerase, hydrolysis buffer, magnesium acetate fusion and RNaseFree ddH 2...
Embodiment 3
[0045] The present embodiment provides a rapid on-site detection method for canine distemper using the kit described in Embodiment 1, which is a visual on-site rapid detection method, which includes the following steps:
[0046] (1) viral RNA or RNA positive standard, with described primer, probe, reverse transcriptase, RNase inhibitor, resuspension buffer and ddH 2 O mix well, add in the reaction tube that recombinase, polymerase and hydrolysis buffer are housed, then add magnesium acetate solution, centrifuge briefly after fully mixing;
[0047] (2) constant temperature amplification reaction;
[0048] (3) The amplification reaction product is detected using a fully enclosed nucleic acid rapid detection device;
[0049] (4) Interpretation of the results, if there is a red band at the position of the quality control line and the detection line by visual observation, then the sample contains canine distemper virus; The sample does not contain canine distemper virus; if there...
PUM
Property | Measurement | Unit |
---|---|---|
Sensitivity | aaaaa | aaaaa |
Abstract
Description
Claims
Application Information

- Generate Ideas
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com