A kind of Bacillus atrophicus e20303 and its application
A technology of Bacillus atrophaeus and bacterial suspension, which is applied in the field of microorganisms, can solve the problems that the selective resistance of pathogens cannot be effectively controlled and the possibility is increased, and achieves the effect of improving the selective resistance and having a good application prospect.
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0021] The separation and purification of embodiment 1 bacterial strain E20303
[0022] Collect lake water samples from Chaerhan Salt Lake in Qinghai, save them and bring them back to the laboratory.
[0023] To enrich the bacteria in the collected Chaerhan Salt Lake water samples: put the filter membranes into the filters respectively, sterilize at 121° C. for 30 minutes, and dry. Under sterile conditions, the water sample was mixed, filtered with a filter equipped with a filter membrane with a pore size of 0.22 μm, and bacteria were enriched on the filter membrane. When the amount of water sample used for enrichment reaches 30mL, take off the filter membrane and put it into a glass test tube filled with 3mL sterile seawater, and it is 10 -1 watery. Shake, and let stand for a while. After that, put 10 -1 Water samples were serially diluted to 10 -2 Water sample and 10 -3 Water sample, spare. Take 200 μL of the above sample, spread it evenly on the medium plate, and cul...
Embodiment 2
[0024] Identification of embodiment 2 bacterial strain E20303
[0025] The 16S rDNA of the strain was extracted according to the operation procedure of the column bacterial DNA extraction kit of Shanghai Sangon Bioengineering (Shanghai) Co., Ltd. Bacterial 16S rDNA universal primers F27 and P1541 were selected for PCR amplification.
[0026] F27:agagtttgatcctggctcagg;
[0027] P1541: aaggaggtggtgatccagccgca.
[0028] PCR reaction system (25 μL): 10×Buffer 2.5 μL, template DNA 1 μL, Taq enzyme (5U / μL) 0.2 μL, dNTPs (2.5 mmol / μL) 2 μL, primers (10 pmol / μL) 1 μL each, ddH 2 O 17.3 μL.
[0029] The reaction conditions are: 94°C for 5 minutes; 94°C for 30s, 55°C for 30s, 72°C for 80s, a total of 30 cycles; 72°C for 10min.
[0030] After the PCR amplification product was detected on 1.0% agarose gel electrophoresis, sequence determination was carried out. The sequence result is shown as SEQID No.1.
[0031] Comparing the measured 16S sequence in the National Center for Biologi...
Embodiment 3
[0033] The configuration of embodiment 3 bacterial strain E20303 culture medium
[0034] 1) In ATCC213 modified medium (MgSO 4 ·7H 2 O 10g, CaCl 2 2H 2 O 0.2g, KCl 5g, peptone 2.5g, yeast extract 10g, NaCl 30g, distilled water to 1000mL, pH 7.2-7.4), add different carbon sources (glucose, sucrose, starch, corn flour, glycerin), other ingredients and content The inhibitory activity of the aseptic fermentation broth of moderate halophilic bacteria E20303 on potato dry rot pathogenic fungi was determined after fermenting on a shaker at 28°C with a rotation speed of 180r / min for 7 days.
[0035]The results showed that under different carbon source conditions, the aseptic fermentation broth of strain E20303 had inhibitory activity against the pathogenic fungus of potato dry rot. Among them, with the extension of confrontation culture time, the inhibition rate increased gradually. The inhibitory activity of strain E20303 to pathogenic fungi from high to low is: starch, corn flo...
PUM
| Property | Measurement | Unit |
|---|---|---|
| control rate | aaaaa | aaaaa |
Abstract
Description
Claims
Application Information
Login to View More 


