Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Bacillus atrophaeus E20303 and application thereof

A technology of bacillus atrophaeus and bacterial suspension, applied in the field of microorganisms, can solve the problems of increased possibility, selective resistance of pathogens and inability to achieve effective control, etc., and achieves good application prospects

Active Publication Date: 2020-02-07
QINGHAI UNIVERSITY
View PDF9 Cites 2 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

These microorganisms with broad biocontrol prospects are mainly isolated from terrestrial resources such as the rhizosphere or rhizosphere soil, plant diseased parts, plant interiors, and insect body cavities, which makes it possible to isolate similar functional strains and active compounds from terrestrial resources Increased resistance, but it will cause selective resistance of pathogens and cannot achieve effective control.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Bacillus atrophaeus E20303 and application thereof
  • Bacillus atrophaeus E20303 and application thereof
  • Bacillus atrophaeus E20303 and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0021] The separation and purification of embodiment 1 bacterial strain E20303

[0022] Collect lake water samples from Chaerhan Salt Lake in Qinghai, save them and bring them back to the laboratory.

[0023] To enrich the bacteria in the collected Chaerhan Salt Lake water samples: put the filter membranes into the filters respectively, sterilize at 121° C. for 30 minutes, and dry. Under sterile conditions, the water sample was mixed, filtered with a filter equipped with a filter membrane with a pore size of 0.22 μm, and bacteria were enriched on the filter membrane. When the amount of water sample used for enrichment reaches 30mL, take off the filter membrane and put it into a glass test tube filled with 3mL sterile seawater, and it is 10 -1 watery. Shake, and let stand for a while. After that, put 10 -1 Water samples were serially diluted to 10 -2 Water sample and 10 -3 Water sample, spare. Take 200 μL of the above sample, spread it evenly on the medium plate, and cul...

Embodiment 2

[0024] Identification of embodiment 2 bacterial strain E20303

[0025] The 16S rDNA of the strain was extracted according to the operation procedure of the column bacterial DNA extraction kit of Shanghai Sangon Bioengineering (Shanghai) Co., Ltd. Bacterial 16S rDNA universal primers F27 and P1541 were selected for PCR amplification.

[0026] F27:agagtttgatcctggctcagg;

[0027] P1541: aaggaggtggtgatccagccgca.

[0028] PCR reaction system (25 μL): 10×Buffer 2.5 μL, template DNA 1 μL, Taq enzyme (5U / μL) 0.2 μL, dNTPs (2.5 mmol / μL) 2 μL, primers (10 pmol / μL) 1 μL each, ddH 2 O 17.3 μL.

[0029] The reaction conditions are: 94°C for 5 minutes; 94°C for 30s, 55°C for 30s, 72°C for 80s, a total of 30 cycles; 72°C for 10min.

[0030] After the PCR amplification product was detected on 1.0% agarose gel electrophoresis, sequence determination was carried out. The sequence result is shown as SEQID No.1.

[0031] Comparing the measured 16S sequence in the National Center for Biologi...

Embodiment 3

[0033] The configuration of embodiment 3 bacterial strain E20303 culture medium

[0034] 1) In ATCC213 modified medium (MgSO 4 ·7H 2 O 10g, CaCl 2 2H 2 O 0.2 g, KCl 5g, peptone 2.5g, yeast extract 10g, NaCl 30g, distilled water to 1000mL, pH 7.2-7.4), add different carbon sources (glucose, sucrose, starch, corn flour, glycerin), other ingredients and content The inhibitory activity of the aseptic fermentation broth of moderate halophilic bacteria E20303 on the pathogenic fungus of potato dry rot was determined after fermentation at 28°C and 180r / min on a shaker for 7 days.

[0035]The results showed that under different carbon source conditions, the aseptic fermentation broth of strain E20303 had inhibitory activity against the pathogenic fungus of potato dry rot. Among them, with the extension of confrontation culture time, the inhibition rate increased gradually. The inhibitory activity of strain E20303 to pathogenic fungi from high to low is: starch, corn flour, glucos...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

PropertyMeasurementUnit
control rateaaaaaaaaaa
Login to View More

Abstract

The invention discloses Bacillus atrophaeus E20303 and application thereof. The Bacillus atrophaeus E20303 has been preserved in Guangdong Microbial Culture Collection Center under the preservation number GDMCC No: 60695 since June 17, 2019. The Bacillus atrophaeus E20303 is capable of effectively inhibiting potato diseases caused by fusarium solani and potato virus Y. The Bacillus atrophaeus E20303 is a moderately halophilic bacterium which is isolated and purified from the water of Qarhan Salt Lake in Qinghai Province, and provides a new way for controlling potato diseases caused by fusariumsolani and potato virus Y; and moreover, the Bacillus atrophaeus E20303 is capable of effectively improving the problem of failure to achieve prevention and control effects caused by selective resistance of pathogens. Therefore, the Bacillus atrophaeus E20303 has good prospects of application.

Description

technical field [0001] The invention belongs to the technical field of microorganisms, and in particular relates to a bacillus atrophaeus E20303 and an application thereof. Background technique [0002] Potato is an annual cultivated herbaceous stem and tuber crop, which has many other names and is native to the Americas. In my country, it is another staple food besides corn, wheat and rice, and it can be eaten as food and vegetables at the same time. In 2003, the United Nations Food and Agriculture Organization statistics showed that the total potato cultivation area in the world was about 19 million hectares, and the potato cultivation area in China alone was as high as 5 million hectares. Although my country's potato planting area is expanding, there are still few unfavorable factors in its current status and future prospects. With the increasing potato planting area in our country and continuous planting on the same field, the types of diseases and the degree of damage...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12N1/20A01N63/22A01P1/00C12R1/07
CPCA01N63/00C12N1/20C12N1/205C12R2001/07
Inventor 沈硕李玮王舰
Owner QINGHAI UNIVERSITY
Features
  • Generate Ideas
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More