Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Kit for detecting copy number mutation of HER2 of CTCs based on ddPCR and method

A gene copy number and kit technology, which is applied in the field of HER2 copy number variation kits, can solve the problems of poor endocrine therapy effect, short chemotherapy remission period, and high risk of metastasis, achieving low cost, good repeatability, and good repeatability Effect

Pending Publication Date: 2020-04-03
苏州绘真医学检验有限公司
View PDF4 Cites 4 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

It is clinically found that HER2 is associated with tumor burden and lymph node status in breast cancer patients, with high risk of metastasis, poor prognosis, rapid disease progression, short chemotherapy remission period, and poor endocrine therapy effect. Cyclophosphamide, doxorubicin, 5- Main reference index of fluorouracil and Herceptin

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Kit for detecting copy number mutation of HER2 of CTCs based on ddPCR and method
  • Kit for detecting copy number mutation of HER2 of CTCs based on ddPCR and method
  • Kit for detecting copy number mutation of HER2 of CTCs based on ddPCR and method

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0028] Example 1: Specific PCR primers and detection probe sequences for detecting copy number variation of HER2 gene

[0029] 1. Sequence acquisition: The HER2 and EFTUD2 gene detection sites involved in the present invention are shown in Table 1.

[0030] Table 1

[0031] gene Gene locus region HER217q12 EFTUD217q21.31

[0032] 2. Design method: Design specific primers and detection probes according to the HER2 and EFTUD2 gene sequences published by NCBI database (Table 2).

[0033] Table 2. Sequences of HER2, EFTUD2 primers and detection probes

[0034] Primer name Primer sequence Fluorescence Sequence name HER2-F CTAGCACC TTGCTAAGCA SEQ ID NO: 1 HER2-R AGCACCATTCACAGAAA SEQ ID NO: 2 HER2-P CCAGGAGGCACCATTCACATTG FAM SEQ ID NO: 3 EFTUD2-F CTTCCTTCTTGCCTATTC SEQ ID NO: 4 EFTUD2-R CTGTCTAGTCTTAGTCTTATG SEQ ID NO: 5 EFTUD2-P TGCCTCCTCTCCAGTGAC CY5 SEQ ID NO: 6

Embodiment 2

[0035] Embodiment 2: A kit and method for detecting HER2 copy number variation of CTCs based on ddPCR is used to detect the copy number variation of HER-2 gene in negative samples.

[0036] Among them, the negative control sample is: DNA extracted from K562 cell line diluted to 1ng / μl; the positive control sample is: DNA extracted from SW480 cell line diluted to 1ng / μl.

[0037] 1. Separation of CTCs

[0038] Take the circulating tumor cells of a patient with a negative tumor of the HER2 gene copy number variant as an example. Take 4-10ml of whole blood from tumor patients and centrifuge to separate plasma. For plasma Each system is enriched with CTCs and requires no less than 20 CTCs and 10μl NFH 2 O resuspend the cells.

[0039] 2. Digital PCR reaction solution preparation

[0040] Thaw 5× primer mixture and 2× quantitative premix at 1.4°C, vortex these reagents for 5-10 seconds, centrifuge at 1000 rpm for 10 seconds, and collect the reagents to the bottom of the tube.

[0041] 5×pr...

Embodiment 3

[0064] Example 3: A kit and method for detecting HER2 copy number variation of CTCs based on ddPCR is used to detect the copy number variation of HER-2 gene in positive samples.

[0065] CTCs separation

[0066] Take the circulating tumor cells of a patient with a negative tumor of the HER2 gene copy number variant as an example. Take 4-10ml of whole blood from tumor patients and centrifuge to separate plasma. For plasma Each system is enriched with CTCs and requires no less than 20 CTCs and 10μl NFH 2 O resuspend the cells.

[0067] Digital PCR reaction solution preparation

[0068] Thaw 5× primer mixture and 2× quantitative premix at 1.4°C, vortex these reagents for 5-10 seconds, centrifuge at 1000 rpm for 10 seconds, and collect the reagents to the bottom of the tube.

[0069] 5×primer mixture, the primers and probes shown in SEQ ID NO: 1, 2, 3, 4, 5, 6 in Table 1 are mixed in a ratio of 1:1:1:1:1:1:1;

[0070] 2× quantitative premix contains: potassium chloride (100mmol / L), magnes...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to kits and applications thereof, particularly relates to a kit for detecting copy number mutation of HER2 of CTCs based on ddPCR and a method and belongs to the technical fieldof nucleic acid detection. The kit for detecting the copy number mutation of the HER2 of the CTCs based on the ddPCR comprises a nucleotide sequence for detecting the copy number mutation of the geneHER2, primer pairs shown in SEQ ID NO: 1~6, a detecting probe 1, a detecting probe 2, a premix and calibration standard substances (including a negative reference substance and a positive reference substance). The kit is used for detecting cycling tumor cells and achieves noninvasive, high-sensitivity and high-accuracy real-time monitoring on tumor medication, medication monitoring, recurrence detection and the like. The kit has good absolute quantitative accuracy, sensitivity and repeatability to samples of a small input amount and has a good detection result to low-frequency mutations.

Description

Technical field [0001] The invention relates to a kit and its application, in particular to a kit and a method for detecting HER2 copy number variation of CTCs based on ddPCR, and belongs to the technical field of nucleic acid detection. Background technique [0002] Circulating tumor cells (CTCs) refer to various types of tumor cells that have separated from the tumor's primary site and metastatic site and entered the blood circulation. CTC has obvious advantages in early tumor detection, drug guidance, prognostic recurrence detection, and tumor metastasis prompting. 1. Early diagnosis of malignant tumors. Studies have shown that a small amount of CTCs can also be detected in the peripheral blood of patients with early asymptomatic malignant tumors; 2. CTCs have similar genetic characteristics to the primary tumor cells and can achieve non-invasive, Continue to monitor the course of the tumor and guide the medication; third, continue to monitor the prognosis of recurrence. [00...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12Q1/6851C12N15/11
CPCC12Q1/6851C12Q2531/113C12Q2563/107C12Q2537/16C12Q2545/113
Inventor 张惠丹戴敬杨丽萍赵洪玉
Owner 苏州绘真医学检验有限公司
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com