Method for improving yield of metabolic products of saccharomyces cerevisiae
A technology of Saccharomyces cerevisiae and metabolites, applied in the biological field, can solve problems such as gene expression fluctuations, unfavorable batch stability, instability, etc., and achieve the effect of improving β-carotene
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0064] The construction of embodiment 1 gene editing vector
[0065] All gene integration and DNA fragment replacement on the genome in the present invention adopt the method of gene editing. Therefore, the present invention pre-constructs a series of gene editing vectors for subsequent examples. The constructed gene editing vectors all use pCAS9W03 as the starting vector (patent application number: 201910754882.3). The N20 sequence on the original vector is replaced by fusion PCR to obtain different gene editing targeting vectors. The editing site is designed using sgRNA online design tool, the website link is: http: / / crispr.dbcls.jp / .
[0066] The primer sequences required to construct the gene editing vector are shown in Table 1, where the underlined part is the N20 replacement region, which is the target region of the corresponding site on the genome.
[0067] Table 1:
[0068]
[0069]
[0070] The construction process of the vector is shown in Table 2.
[0071] ...
Embodiment 2
[0075] Embodiment 2 Transformation of Cu ion-induced GAL regulation system
[0076] (1) Preparation of pCRT3 donor DNA and replacement of pGAL80 promoter
[0077] Saccharomyces cerevisiae HEC-YLK genome was used as a template, and the nucleic acid sequence: PCTR3-F2: TTTTCTTCATTTACCGGCGCACTCTCGCCCGAACGACCTCAAAATGTCTGCGTATTCCAA TGAGAATCGCTAG and PCTR3-R2: GGAGCTGCATTAGGCACGGTTGAGACCGAAGATCTTGTTGTAGTCCATCTTTTGTATA GCCCTTAAATG were used as primers for amplification. The 5' ends of the upstream and downstream primers each have a 50bp homologous region with the upstream and downstream of the pGAL80 promoter.
[0078] (2) Preparation of pCUP1 donor DNA and replacement of pGAL4 promoter
[0079] Saccharomyces cerevisiae HEC-YLK genome was used as a template, and nucleic acid sequence: 046-CUP1p-F: AGGGGCGATTGGTTTGGGTGCGTGAGCGGCAAGAAGTTTCGTAAGCCGATCCCATTA CCG and 047-CUP1p-R: AGAAGACAGTAGCTTCATCTTTCAGGAGGCTTGCTTCTCTGTCAGTTTGTTTTTCTTAA TATCTATTTCG were used as primers for high-fidelit...
Embodiment 3
[0088] Embodiment 3 Construction of copper ion-inducible Beta-carotene bacterial strain
[0089] (1) Synthesis of Beta-carotene synthesis pathway genes
[0090] The beta-carotene synthesis pathway gene BtcrtE (GGPP synthase, GenBank:: AFC92798.1), BtcrtI (phytoene dehydrogenase , GenBank:: AAX20903.1) and BtcrtYB (phytoene synthase / cyclase bifunctional enzyme, GenBank:: Q67GH9.1) for codon optimization and gene synthesis. The optimized gene sequence is shown in Table 4.
[0091] Table 4:
[0092]
[0093]
[0094]
[0095]
[0096] (2) Preparation of beta-carotene synthesis pathway gene donor DNA
[0097] During gene synthesis, two restriction sites, EcoRI and BglII, are added to the upstream and downstream of the BtcrtE gene, two restriction sites, EcoRI and BglII, are added to the upstream and downstream of the BtcrtI gene, and two restriction sites, EcoRI and BglII, are added to the upstream and downstream of the BtcrtYB gene, respectively. Two enzyme cutting ...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More 


