Unlock instant, AI-driven research and patent intelligence for your innovation.

Method for improving yield of metabolic products of saccharomyces cerevisiae

A technology of Saccharomyces cerevisiae and metabolites, applied in the biological field, can solve problems such as gene expression fluctuations, unfavorable batch stability, instability, etc., and achieve the effect of improving β-carotene

Active Publication Date: 2020-04-10
HEC PHARM
View PDF7 Cites 6 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, glucose is a commonly used carbon source in the fed-batch fermentation process. The instability of the fed-batch process will lead to large fluctuations in the expression of the gene controlled by the GAL promoter, which does not take advantage of the batch-to-batch stability in the large-scale production process.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Method for improving yield of metabolic products of saccharomyces cerevisiae
  • Method for improving yield of metabolic products of saccharomyces cerevisiae
  • Method for improving yield of metabolic products of saccharomyces cerevisiae

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0064] The construction of embodiment 1 gene editing vector

[0065] All gene integration and DNA fragment replacement on the genome in the present invention adopt the method of gene editing. Therefore, the present invention pre-constructs a series of gene editing vectors for subsequent examples. The constructed gene editing vectors all use pCAS9W03 as the starting vector (patent application number: 201910754882.3). The N20 sequence on the original vector is replaced by fusion PCR to obtain different gene editing targeting vectors. The editing site is designed using sgRNA online design tool, the website link is: http: / / crispr.dbcls.jp / .

[0066] The primer sequences required to construct the gene editing vector are shown in Table 1, where the underlined part is the N20 replacement region, which is the target region of the corresponding site on the genome.

[0067] Table 1:

[0068]

[0069]

[0070] The construction process of the vector is shown in Table 2.

[0071] ...

Embodiment 2

[0075] Embodiment 2 Transformation of Cu ion-induced GAL regulation system

[0076] (1) Preparation of pCRT3 donor DNA and replacement of pGAL80 promoter

[0077] Saccharomyces cerevisiae HEC-YLK genome was used as a template, and the nucleic acid sequence: PCTR3-F2: TTTTCTTCATTTACCGGCGCACTCTCGCCCGAACGACCTCAAAATGTCTGCGTATTCCAA TGAGAATCGCTAG and PCTR3-R2: GGAGCTGCATTAGGCACGGTTGAGACCGAAGATCTTGTTGTAGTCCATCTTTTGTATA GCCCTTAAATG were used as primers for amplification. The 5' ends of the upstream and downstream primers each have a 50bp homologous region with the upstream and downstream of the pGAL80 promoter.

[0078] (2) Preparation of pCUP1 donor DNA and replacement of pGAL4 promoter

[0079] Saccharomyces cerevisiae HEC-YLK genome was used as a template, and nucleic acid sequence: 046-CUP1p-F: AGGGGCGATTGGTTTGGGTGCGTGAGCGGCAAGAAGTTTCGTAAGCCGATCCCATTA CCG and 047-CUP1p-R: AGAAGACAGTAGCTTCATCTTTCAGGAGGCTTGCTTCTCTGTCAGTTTGTTTTTCTTAA TATCTATTTCG were used as primers for high-fidelit...

Embodiment 3

[0088] Embodiment 3 Construction of copper ion-inducible Beta-carotene bacterial strain

[0089] (1) Synthesis of Beta-carotene synthesis pathway genes

[0090] The beta-carotene synthesis pathway gene BtcrtE (GGPP synthase, GenBank:: AFC92798.1), BtcrtI (phytoene dehydrogenase , GenBank:: AAX20903.1) and BtcrtYB (phytoene synthase / cyclase bifunctional enzyme, GenBank:: Q67GH9.1) for codon optimization and gene synthesis. The optimized gene sequence is shown in Table 4.

[0091] Table 4:

[0092]

[0093]

[0094]

[0095]

[0096] (2) Preparation of beta-carotene synthesis pathway gene donor DNA

[0097] During gene synthesis, two restriction sites, EcoRI and BglII, are added to the upstream and downstream of the BtcrtE gene, two restriction sites, EcoRI and BglII, are added to the upstream and downstream of the BtcrtI gene, and two restriction sites, EcoRI and BglII, are added to the upstream and downstream of the BtcrtYB gene, respectively. Two enzyme cutting ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention provides a GAL gene regulation and control system. In the GAL gene regulation and control system, pCTR3 or pCTR1 is operably linked with a GAL80 gene, and pCUP1 is operably linked to a GAL4 gene. In experiments, the inventor unexpectedly finds that a copper ion inhibition type CTR3 gene promoter (pCTR3) or a CTR1 gene promoter (pCTR1) is adopted to replace a pGAL80 promoter (pGAL80),and a copper ion induction type CUP1 gene promoter (pCUP1) is adopted to replace a pGAL4 promoter (pGAL4), so that the GAL gene regulation and control system can realize expression control of a geneunder induction of copper ions, the yield of metabolic products of engineering bacteria carrying the GAL gene regulation and control system is remarkably improved, and the GAL gene regulation and control are not influenced by glucose concentration in the system.

Description

technical field [0001] The invention relates to the field of biotechnology, in particular, the invention relates to a GAL gene regulation system, Saccharomyces cerevisiae and a method for improving the yield of Saccharomyces cerevisiae metabolites. Background technique [0002] Saccharomyces cerevisiae is a generally recognized as safe microorganism (Generally Recognized as Safe, GRAS). Human beings have relatively clear research on its physiology, biochemistry and genetic background, and the genetic manipulation is relatively simple. Therefore, in recent years, synthetic biology and It plays a pivotal role in metabolic engineering research. Saccharomyces cerevisiae is not only used to ferment ethanol and make beer, but it has become a common host for the synthesis of high value-added natural products. [0003] In most studies, the expression of foreign genes in Saccharomyces cerevisiae adopts strong constitutive promoters, such as commonly used pTEF1 promoter, pHXT7 promot...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N1/19C12N15/113C12N15/31C12P1/02C12R1/865
CPCC07K14/395C12P1/02C12R2001/645C12N1/145
Inventor 谢文平蔡燕丰姚红涛吴广进毛兴艳鲍素敏万丹
Owner HEC PHARM