A FRET-based fusion protein, fluorescent nanoparticles and applications thereof

A fluorescent nanoparticle and fusion protein technology, which is applied in the direction of fusion polypeptides, hybrid peptides, DNA/RNA fragments, etc., can solve the problems affecting the determination of the test data of the subjects, the limitation of signal-to-noise ratio, and the limited number of fluorescent dyes.

Active Publication Date: 2022-02-18
WUHAN INST OF VIROLOGY CHINESE ACADEMY OF SCI
View PDF0 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, the number of such modified fluorescent dyes is limited, the background value of the fluorescent signal is high, and its stability, sensitivity, and signal-to-noise ratio are greatly limited.
For example, human serum contains a variety of fluorescent substances. Under the excitation of excitation light, the fluorescence emission spectrum of normal human serum basically covers the entire range of visible light (background signal) (Zhu Dianming, Jin Wanxiang, Luo Xiaosen, et al. Human serum hematoporphyrin Biorthogonal spline wavelet identification of fluorescence spectrum [J]. Spectroscopy and Spectral Analysis, 2008 (08): 185-188.), this background fluorescence has a great effect on the fluorescence detection of most clinical blood or serum samples Interference, which seriously affects the judgment of the test data of the subject
Another example is in the imaging of live animals, there are also the problems of animal autofluorescence interference and poor fluorescence penetration (Chen Ling, Gao Jun, Xiong Xiaofeng, et al. Research progress in live bio-optical molecular imaging technology[J]. Medical Review, 2010,16(24):3800-3802.)

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • A FRET-based fusion protein, fluorescent nanoparticles and applications thereof
  • A FRET-based fusion protein, fluorescent nanoparticles and applications thereof
  • A FRET-based fusion protein, fluorescent nanoparticles and applications thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0072] Example 1. Preparation of FRET donor-acceptor pairs

[0073] Green fluorescent protein mClover3: GenBank Accession No.: KX987298.1, 717bp;

[0074] Red fluorescent protein mScarlet-I: GenBank Accession No.: KY021423, 696bp;

[0075] The amino acid sequence of the flexible connecting chain is: SGLRSRAQASNSAVDGT.

[0076] The genes of green fluorescent protein mClover3 and red fluorescent protein mScarlet-I were respectively used as templates for PCR amplification. Wherein, the green fluorescent protein PCR amplification primers are:

[0077] mClover3-F:GTGAGCAAGGGCGAGGAGC

[0078] mClover3-R:GGCATGGACGAGCTGTACAAG

[0079] The red fluorescent protein PCR amplification primers are:

[0080] mScarlet-I-F:GTGAGCAAGGGCGAGGCAG

[0081] mScarlet-I-R:GCATGGACGAGCTGTACAAG

[0082] The above-mentioned flexible linker chain was inserted between mScarlet-I and mClover3. At the same time, a Strep tag was added to the 5' end of mScarlet-I to facilitate later protein purificati...

Embodiment 2

[0084] Example 2. Construction of recombinant expression vector

[0085] In this example, the mScarlet-I-linker-mClover3 structure constructed in Example 1 was inserted into the HBcAg gene through genetic modification.

[0086] Using the mScarlet-I-connecting strand-mClover3 gene in Example 1 as a template, PCR amplification was performed using the following primers to obtain a PCR product of mScarlet-I-connecting strand-mClover3.

[0087] mScarlet-I-F: GTGAGCAAGGGCGAGGCAG;

[0088] mClover3-R: GGCATGGACGAGCTGTACAAG.

[0089] The HBcAg gene sequence used in this example is GenBank Accession No: CAA24706.

[0090] The HBcAg gene was split into N-terminal (core-N) and C-terminal (core-C) parts at the c / e1 loop. The 5' end of the FRET fluorescent protein pair can be fused to the 3' end of core-N (Scheme 1), or the 3' end of the FRET fluorescent protein pair can be fused to the 5' end of core-C (Scheme 2). figure 2 Shown is a schematic diagram of the structure of the FRET don...

Embodiment 3

[0095] Example 3. Induced expression and detection of Escherichia coli

[0096] The gene sequence inserted into mScarlet-I-linker-mClover3 in the HBcAg prepared in Example 2 was cloned into the expression vector of pET32a, using CaCl 2 Transformation method Transform into competent Escherichia coli Rosetta cells, culture the transformed cells on ampicillin medium, and screen out positive clones with exogenous DNA molecules. After sequencing, it was proved that mScarlet-I-connecting strand-mClover3 had been correctly inserted into the c / e1 loop of the HBcAg gene.

[0097] The correct positive clones obtained were first expanded and cultured in LB medium, and then the expression was induced by adding IPTG at a final concentration of 1M at 25°C. Expression of HBcAg virus-like nanoparticles displaying FRET donor-acceptor pairs in Rosetta E. coli. The induced cells of HBcAg virus-like nanoparticles displaying the mScarlet-I-mClover3 donor-acceptor pair were collected by centrifug...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

PropertyMeasurementUnit
diameteraaaaaaaaaa
Login to View More

Abstract

The invention belongs to the field of biotechnology, and specifically relates to a FRET-based fusion protein, fluorescent nanoparticles and applications thereof. The fusion protein comprises viral structural proteins capable of self-assembly into virus-like particles; and a donor-acceptor pair capable of realizing fluorescence resonance energy transfer. The present invention also provides a virus-like fluorescent nanoparticle assembled from the fusion protein. While improving the FRET efficiency, the fluorescent nanoparticle also greatly improves the fluorescent signal output during its function as a fluorescent probe. Improve the sensitivity and stability of the detection while reducing the background value and improving the signal-to-noise ratio; in application, it can be directly connected to the targeting ligand, which can ensure the FRET effect of the fluorescent protein pair, with good stability and high sensitivity, making the experimental results error The experimental results are closer to reality.

Description

technical field [0001] The invention belongs to the field of biotechnology, and specifically relates to a FRET-based fusion protein, fluorescent nanoparticles and applications thereof. Background technique [0002] Fluorescence Resonance Energy Transfer (FRET) refers to two different fluorescent chromophores, where the emission spectrum of one fluorescent chromophore (donor) is different from that of the other fluorescent chromophore (acceptor). There is a certain overlap in the absorption spectrum of the donor molecule. When the donor molecule is excited, the acceptor and the donor are separated by a certain distance, and the energy between the vibration levels of the ground state and the first electronic excited state of the donor and the acceptor When there is poor mutual adaptation, the donor in the excited state will transfer part or all of the energy to the acceptor through the mediation of dipoles, so that the acceptor is excited, and the entire energy transfer proces...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityPatents(China)
IPC IPC(8): C07K19/00C12N15/62G01N33/58
CPCC07K14/005G01N33/582C07K2319/00C12N2730/10123
Inventor门冬张先恩陈晨周娟
OwnerWUHAN INST OF VIROLOGY CHINESE ACADEMY OF SCI