FRET-based fusion protein, and fluorescent nanoparticle and application thereof

A fluorescent nanoparticle and fusion protein technology, applied in the direction of fusion polypeptides, hybrid peptides, DNA/RNA fragments, etc., can solve the problems of interfering with fluorescence penetration, high background value of fluorescence signal, and affecting the determination of test data of subjects.

Active Publication Date: 2020-04-17
WUHAN INST OF VIROLOGY CHINESE ACADEMY OF SCI
View PDF0 Cites 6 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, the number of such modified fluorescent dyes is limited, the background value of the fluorescent signal is high, and its stability, sensitivity, and signal-to-noise ratio are greatly limited.
For example, human serum contains a variety of fluorescent substances. Under the excitation of excitation light, the fluorescence emission spectrum of normal human serum basically covers the entire range of visible light (background signal) (Zhu Dianming, Jin Wanxiang, Luo Xiaosen, et al. Human serum hematoporphyrin Biorthogonal spline wavelet identification of fluorescence spectrum [J]. Spectroscopy and Spectral Analysis, 2008 (08): 185-188.), this background fluorescence has a great effect on the fluorescence detection of most clinical blood or serum samples Interference, which seriously affects the judgment of the test data of the subject
Another example is in the imaging of live animals, there are also the problems of animal autofluorescence interference and poor fluorescence penetration (Chen Ling, Gao Jun, Xiong Xiaofeng, et al. Research progress in live bio-optical molecular imaging technology[J]. Medical Review, 2010,16(24):3800-3802.)

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • FRET-based fusion protein, and fluorescent nanoparticle and application thereof
  • FRET-based fusion protein, and fluorescent nanoparticle and application thereof
  • FRET-based fusion protein, and fluorescent nanoparticle and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0072] Example 1. Preparation of FRET donor-acceptor pairs

[0073] Green fluorescent protein mClover3: GenBank Accession No.: KX987298.1, 717bp;

[0074] Red fluorescent protein mScarlet-I: GenBank Accession No.: KY021423, 696bp;

[0075] The amino acid sequence of the flexible connecting chain is: SGLRSRAQASNSAVDGT.

[0076] The genes of green fluorescent protein mClover3 and red fluorescent protein mScarlet-I were respectively used as templates for PCR amplification. Wherein, the green fluorescent protein PCR amplification primers are:

[0077] mClover3-F:GTGAGCAAGGGCGAGGAGC

[0078] mClover3-R:GGCATGGACGAGCTGTACAAG

[0079] The red fluorescent protein PCR amplification primers are:

[0080] mScarlet-I-F:GTGAGCAAGGGCGAGGCAG

[0081] mScarlet-I-R:GCATGGACGAGCTGTACAAG

[0082] The above-mentioned flexible linker chain was inserted between mScarlet-I and mClover3. At the same time, a Strep tag was added to the 5' end of mScarlet-I to facilitate later protein purificati...

Embodiment 2

[0084] Example 2. Construction of recombinant expression vector

[0085] In this example, the mScarlet-I-linker-mClover3 structure constructed in Example 1 was inserted into the HBcAg gene through genetic modification.

[0086] Using the mScarlet-I-connecting strand-mClover3 gene in Example 1 as a template, PCR amplification was performed using the following primers to obtain a PCR product of mScarlet-I-connecting strand-mClover3.

[0087] mScarlet-I-F: GTGAGCAAGGGCGAGGCAG;

[0088] mClover3-R: GGCATGGACGAGCTGTACAAG.

[0089] The HBcAg gene sequence used in this example is GenBank Accession No: CAA24706.

[0090] The HBcAg gene was split into N-terminal (core-N) and C-terminal (core-C) parts at the c / e1 loop. The 5' end of the FRET fluorescent protein pair can be fused to the 3' end of core-N (Scheme 1), or the 3' end of the FRET fluorescent protein pair can be fused to the 5' end of core-C (Scheme 2). figure 2 Shown is a schematic diagram of the structure of the FRET don...

Embodiment 3

[0095] Example 3. Induced expression and detection of Escherichia coli

[0096] The gene sequence inserted into mScarlet-I-linker-mClover3 in the HBcAg prepared in Example 2 was cloned into the expression vector of pET32a, using CaCl 2 Transformation method Transform into competent Escherichia coli Rosetta cells, culture the transformed cells on ampicillin medium, and screen out positive clones with exogenous DNA molecules. After sequencing, it was proved that mScarlet-I-connecting strand-mClover3 had been correctly inserted into the c / e1 loop of the HBcAg gene.

[0097] The correct positive clones obtained were first expanded and cultured in LB medium, and then the expression was induced by adding IPTG at a final concentration of 1M at 25°C. Expression of HBcAg virus-like nanoparticles displaying FRET donor-acceptor pairs in Rosetta E. coli. The induced cells of HBcAg virus-like nanoparticles displaying the mScarlet-I-mClover3 donor-acceptor pair were collected by centrifug...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

PropertyMeasurementUnit
diameteraaaaaaaaaa
Login to View More

Abstract

The invention belongs to the technical field of biology, and particularly relates to a fusion protein based on FRET, and a fluorescent nanoparticle and application thereof. The fusion protein comprises: viral structural protein which can be self-assembled into a virus-like particle; and a donor-acceptor pair capable of achieving fluorescence resonance energy transfer. The invention further provides a virus-like fluorescent nanoparticle which is obtained through self-assembling of the fusion protein. The fluorescent nanoparticle improves FRET efficiency, greatly increases a fluorescence signaloutput quantity when the fluorescent nanoparticle serves as a fluorescent probe, improves detection sensitivity and stability, reduces background value and increases a signal-to-noise ratio. In application of the virus-like fluorescent nanoparticle, the virus-like fluorescent nanoparticle can be directly connected with a targeting ligand, can guarantee the FRET effect of a fluorescent protein pair, is good in stability and high in sensitivity, and allows experimental result errors to be reduced and experimental results to be closer to reality.

Description

technical field [0001] The invention belongs to the field of biotechnology, and specifically relates to a FRET-based fusion protein, fluorescent nanoparticles and applications thereof. Background technique [0002] Fluorescence Resonance Energy Transfer (FRET) refers to two different fluorescent chromophores, where the emission spectrum of one fluorescent chromophore (donor) is different from that of the other fluorescent chromophore (acceptor). There is a certain overlap in the absorption spectrum of the donor molecule. When the donor molecule is excited, the acceptor and the donor are separated by a certain distance, and the energy between the vibration levels of the ground state and the first electronic excited state of the donor and the acceptor When there is poor mutual adaptation, the donor in the excited state will transfer part or all of the energy to the acceptor through the mediation of dipoles, so that the acceptor is excited, and the entire energy transfer proces...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityApplications(China)
IPC IPC(8): C07K19/00C12N15/62G01N33/58
CPCC07K14/005G01N33/582C07K2319/00C12N2730/10123
Inventor门冬张先恩陈晨周娟
OwnerWUHAN INST OF VIROLOGY CHINESE ACADEMY OF SCI