A kind of Lyme recombinant fusion protein ospc-vlse and its application
A fusion protein and Lyme technology, applied in the field of genetic engineering, can solve the problem of low specificity
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Examples
Embodiment 1
[0024] Embodiment 1 Contains the construction of Lyme recombinant fusion protein OspC-VlsE gene expression vector
[0025] Lyme recombinant fusion protein OspC-VlsE gene is designed according to the protein sequences of OspC (NCBI Sequence ID: CAG44438.1) and VlsE (NCBI Sequence ID: ACC99642.1). The antigenic epitopes on it were analyzed, and the most dominant antigenic epitopes were selected for fusion.
[0026] According to the amino acid sequence, the Escherichia coli codon was used to reverse-translate it into a nucleotide sequence, and the obtained nucleotide sequence was as follows: The recombinant gene sequence SEQ ID NO.2 was synthesized by Shanghai Jierui Bioengineering Co., Ltd., and the vector was pET30a.
[0027] SEQ ID NO.2:
[0028]AACACCAGCGCGAACAGCGCGGATGAAAGCGTGAAAGGCCCGAACCTGACCGAAATTAGCAAAAAAATTACCGATAGCAACGCGGTGCTGCTGGCGGTGAAAGAAGTGGAAGCGCTGCTGAGCAGCATTGATGAAATTGCGGCGAAAGCGATTGGCAAAAAAATTCATCAGAACAACGGCCTGGATACCGAAAACAACCATAACGGCAGCCTGCTGGCGGGCGCGTATGCGATT...
Embodiment 2
[0029] Embodiment 2 contains the expression of Lyme recombinant fusion protein OspC-VlsE
[0030] The synthetic Lyme recombinant fusion protein OspC-VlsE plasmid was transformed into Escherichia coli BL21, spread on an LB plate containing 50ug / ml kanamycin (Shanghai Shenggong, product number: K0408), and cultivated overnight at 37. Pick a monoclonal colony, culture it with 300ml LB medium containing the same concentration of kanamycin at 37 degrees until the OD600 reaches about 0.6, and induce expression with IPTG (Shanghai Shenggong, product number: IB0168) with a final concentration of 1mM. The conditions are: 37 degrees, rotating speed 200rpm, 4h. After induction, the culture solution was centrifuged at 4°C at 7000 rpm for 10 minutes to collect the bacteria.
Embodiment 3
[0031] Example 3 Purification and renaturation of Lyme-containing recombinant fusion protein OspC-VlsE
[0032] Use 50ml of loading buffer Binding Buffer (50mM Tris, 0.2M Nacl, pH8.0) to break up the bacteria, and then ultrasonically break it at 400w, ultrasonic for 3s, with an interval of 6s, a total of 180 times, and finally 12000rpm, 30min, 4 degrees Collect the supernatant by centrifugation, and the target protein is in the supernatant. Next, it was purified by Ni+ column, and the target protein was eluted with Elution Buffer (50mM Tris, 0.2M Nacl, 0.5M Imidazole, pH8.0). The purified recombinant protein was dialyzed with dialysis buffer (50 mM Tris, 0.2 M Nacl, pH 8.0), and the dialysis solution was changed every 12 hours for a total of 3 times. The dialyzed protein solution was taken out, filtered through a 0.22um filter, and the concentration was measured by the BCA method, and stored at -20°C for future use.
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More - R&D
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com