Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Method for quantitatively detecting iota-carrageenan by enzymatic method

A quantitative detection and carrageenan technology, which is applied in the field of biotechnology and biochemical detection, can solve the problems of inability to realize sensitive detection, poor reproducibility, cumbersome operation, etc., and achieve excellent enzymatic properties, high accuracy, and fast enzymatic hydrolysis rate Effect

Active Publication Date: 2020-05-05
OCEAN UNIV OF CHINA
View PDF2 Cites 1 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0006] The technical problem to be solved in the present invention is that the commonly used iota-carrageenan quantitative detection methods are phenol-sulfuric acid method and liquid chromatography-tandem mass spectrometry, but these two methods have the disadvantages of poor reproducibility and complex operation, time-consuming and labor-intensive respectively, Can not achieve high sensitivity, good accuracy, easy to operate detection

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Method for quantitatively detecting iota-carrageenan by enzymatic method
  • Method for quantitatively detecting iota-carrageenan by enzymatic method
  • Method for quantitatively detecting iota-carrageenan by enzymatic method

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0034] Embodiment 1: Cloning expression and acquisition of iota-carrageenase Cgi1_Wf in Escherichia coli

[0035] Cultivation of Wenyingzhuangia fucanilytica CZ1127 in 2216E Medium T Until the end of the logarithm and extract the whole genome DNA, design upstream and downstream primers (5'- GACACGGATCCAAAGACAAAGTAGCAGTAAATGATACTACA; 5'- GACACCTCGAGCTATTGATATACTCTTACATAATCTATTTC) according to the target gene, and use the whole genome as a template for PCR. The PCR reaction conditions are: 95°C for 3min, 94°C for 30s, 58°C for 30s, 72°C for 150s, 22 cycles, and finally 72°C for 5 minutes to obtain the iota-carrageenase Cgi1_Wf gene fragment, which was connected to the DH5α vector to form a recombinant plasmid. The recombinant plasmids were introduced into BL21(DE3) competent cells to form recombinant strains. The expression was induced by isopropylthiogalactoside in LB medium containing kanamycin, the induction temperature was 17°C, and the induction time was 12h. Collect the ...

Embodiment 2

[0037] Embodiment 2: Cloning expression and acquisition of iota-carrageenase Cgi1_Wf in Bacillus subtilis

[0038] Cultivation of Wenyingzhuangia fucanilytica CZ1127 in 2216E Medium TUntil the end of the logarithm and extract the whole genome DNA, design upstream and downstream primers (5'-GGCTAATGGGCAGCAGCCATCATCA; 5'-AATGAATTATGTAAGAGTATATCAATAG according to the target gene, use the whole genome as a template to carry out PCR as in Example 1, and obtain the ι-carrageenase Cgi1_Wf gene fragment, Connect to the pHT01 vector to form a recombinant plasmid. Transform the recombinant plasmid into Bacillus subtilis competent cells, screen positive clones and use isopropylthiogalactoside to induce expression in LB culture medium. The induction temperature is 38°C. The induction time is 14h. Collect the bacteria by centrifugation and add a certain amount of 20mM Na 2 HPO 4 -NaH 2 PO 4 Suspension in the buffer solution, and then ultrasonic crushing in an ice-water bath (power 400W...

Embodiment 3

[0039] Embodiment 3: Cloning expression and acquisition of iota-carrageenase Cgi1_Wf in Pichia pastoris

[0040] Cultivation of Wenyingzhuangia fucanilytica CZ1127 in 2216E Medium T Until the end of the logarithm and extract the whole genome DNA, design upstream and downstream primers (5'-TTATAAATGGGCAGCAGCCATCATCA; 5'-GCATGCAGATTATGTAAGAGTATATCAATAG) according to the target gene, and use the whole genome as a template to perform PCR as in Example 1 to obtain the iota-carrageenase Cgi1_Wf gene fragment , connected to the pPIC9k vector to form a recombinant plasmid, which was added to Pichia pastoris GS115 competent cells to form a recombinant cell; positive clones were screened and inoculated in YPD medium, cultured at 30°C for 20h, and then inoculated in BMGY medium, 30°C, Cultivate on a shaking table at 200 rpm until OD600 = 2.0, collect the bacteria by centrifugation, discard the supernatant, resuspend the pellet with BMMY medium, and induce culture with methanol at 200 rpm...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to the technical field of biotechnology and biochemical detection, and in particular to a method for quantitatively detecting iota-carrageenan by an enzymatic method. According to the method, iota-carrageenan is degraded into reducing sugar by utilizing specificity of an iota-carrageenan enzyme; a p-hydroxybenzoylhydrazine solution is added for a color reaction after the enzyme is inactivated; centrifuging is carried out, and then the light absorption value of the supernatant is measured at 400-420nm; and the iota-carrageenan content is obtained by comparing the light absorption value with a standard curve. The detection method disclosed by the invention has the advantages of good linear range and high accuracy, and can be popularized and used in the market.

Description

technical field [0001] The invention relates to the technical fields of biotechnology and biochemical detection, in particular to a method for quantitatively detecting iota-carrageenan by enzymatic method. Background technique [0002] Carrageenan (carrageenan), also known as carrageenan or carrageenan, is a natural anionic sulfate linear polysaccharide extracted from the cell walls of red algae such as carrageen, Eucheuma, and firella. According to the sulfate group on galactose in the structure There are many types of carrageenans depending on the number and linking position and the content of 3,6-anhydrogalactose. ι-carrageenan is one of three common types of carrageenan (κ-, ι-, and λ-carrageenan), which consist of alternating sulfated-α-D-3,6-anhydrogalactose and sulfated-β- Composed of D-galactose residues, due to its wide range of sources and diverse functions, it is used in many industrial productions such as food, medicine, cosmetics, etc., as a coagulant, binder, ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12Q1/34G01N30/02G01N21/31
CPCC12Q1/34G01N30/02G01N21/31G01N2400/32G01N2333/924
Inventor 常耀光申晶晶薛长湖陈广宁曹斯琦梅轩玮王玉明
Owner OCEAN UNIV OF CHINA
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com