A kind of rice moisture-sensitive sterile gene and its application and sterile line breeding method
A moisture-sensitive, genetic technology, applied in the fields of application, genetic engineering, plant genetic improvement, etc., can solve the problem of insecurity in seed production and achieve the effect of ensuring production safety
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0057] Example 1: Isolation and phenotypic analysis of hms1 mutants
[0058] We isolated a male sterile mutant from the tissue cultured japonica rice variety Zhonghua 11 (ZH11) (Oryza sativa L.ssp.japonica) rice regenerating line, tentatively named hms1 mutant.
[0059] The hms1 mutant has a very low self-seeding rate when planted under natural conditions (24-35°C, relative humidity 50-90%), and the seed-setting rate of different ears varies greatly. The seed-setting rate of this mutant is similar to that of ZH11. ratio was significantly reduced (only 10% in hms1 mutants), as figure 1 shown, figure 1 a is the whole plant morphology of Zhonghua 11 (ZH11) and hms1 mutants grown in paddy fields in Guangzhou, China (50-90% RH), figure 1 b is the seedlings of ZH11 and hms1 plants grown in paddy fields.
[0060] The phenotypic growth of the hms1 mutant and ZH11 in an artificial climate room at different temperatures and different humidity is shown in Fig. figure 1 As shown in ...
Embodiment 2
[0062] Example 2: Gene Mapping and Gene Cloning
[0063] F produced by crossing ZH11 with hms1 mutants 2 Genetic analysis of the population showed a segregation ratio of 3:1 for wild-type and hms1 phenotypes (161:635, X2=0.17; 0.70>P>0.50; n=1), indicating that hms1 is controlled by a single recessive gene.
[0064] To clone the hms1 gene, two Fs were generated from crosses of hms1 mutants with rice cultivar 02428 or Annon N 2 group. According to linkage analysis and graph-based cloning, results such as figure 2 shown.
[0065] in, figure 2 a is the fine mapping of hms1 on chromosome 3. The number of recombinants at the molecular marker was recorded. The hms1 region is located within a 45 kb gap between molecular markers 306291 and 306336 of the BAC clone OSJNBa0024O21. Using the Rice Genome Annotation Project database (http: / / rapdb.dna.affrc.go.jp / ), seven open reading frames were predicted in this region, and LOC_Os03g12030 was identified as a candidate gene in th...
Embodiment 3
[0068] Example 3: Functional Complementary Verification
[0069] To verify that disruption of LOC_Os03g12030 results in a humidity-sensitive sterile (HGMS) phenotype in hms1, functional complementation experiments were performed by introducing a 4176 bp genomic fragment of wild-type LOC_Os03g12030 into hms1 mutants.
[0070] The 4176bp wild-type genomic DNA was amplified from the ZH11 genomic DNA using the hms1FC F / R primer pair, the sequence of which is shown in SEQ ID No. 9; and the pCAMBIA1380 vector plasmid was digested by HindIII and BglII;
[0071] hms1FC F:AAAAAAGCTTTTGCAGCCAAAGGACCACACT;
[0072] hms1FC R:AAAAAGATCTGAGTACGCAGTTGTAATCAGG;
[0073] The above vector plasmids were transformed into rice using Agrobacterium-mediated transformation, respectively, and the transgenic plants were identified using hygromycin phosphotransferase amplification, and hms1FC1 plants and hms1FC2 plants were obtained.
[0074] Whole plant morphology, seed setting rate and pollen grai...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More