Primer combination, kit and method for detecting autosomal copy number variation

A copy number variation and primer combination technology, applied in biochemical equipment and methods, recombinant DNA technology, microbial assay/inspection, etc., can solve the problems of high probe specificity, high cost, and high detection cost, and eliminate the The effect of sample contamination, short testing period and low testing cost

Active Publication Date: 2020-06-19
GENETRON HEALTH (BEIJING) CO LTD
View PDF5 Cites 2 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0003] There are many existing CNV detection technologies, such as fluorescence in situ hybridization technology, microarray technology, SNP typing chip, oligonucleotide microarray analysis technology, multiple ligation probe amplification technology, and next-generation high-throughput sequencing-based The whole genome sequencing technology of the platform, etc., although the detection technology is diverse, due to the limited detection area, cumbersome operation process, poor stability, low sensitivity, or high detection cost, etc., all limit the detection of chromosome copy number variation. application promotion
Among them: Whole-genome sequencing based on next-generation sequencing is the most effective and accurate technology for detecting chromosome copy number variation, which can truly reflect the copy number levels of different regions of chromosomes. However, the biggest problem with this technology is that the cost of detection is too high , but can not be widely used in practical applications; single nucleotide polymorphism typing chip, which analyzes the difference in copy number by comparing the average value of the hybridization signal intensity of the DNA to be tested and the hybridization signal of the control microarray, its shortcomings The SNP distribution in the high-density chip is uneven, the density of SNP probes in repetitive regions and complex regions is relatively poor, the definition is not enough, and the detection effect is poor. At the same time, the cost of this detection method is high; the multiple connection probe amplification technology is Two adjacent probes are designed according to the target site, and the 5' ends of all probes are connected with universal primers. The copy number detection is realized by comparing the difference between the test sample and the control sample. This method can quickly and sensitively realize the copy number However, this method can only detect sites with known sequences, and due to the high specificity requirements of probes, it is not suitable for the detection of all sites; fluorescence in situ hybridization technology is a classic cytological detection technology, This detection technology also designs probes for known specific areas, which can locate and accurately quantify the target area, but the detection throughput of this method is low, the cost is high, and the detection personnel are required to have rich experience; while for other detection technologies, For example, RT-qPCR compares the target gene and the reference gene for relative quantification and detects the relative copy number abundance. However, due to the low throughput and limited detection area, it is difficult to be practically applied in the chromosome copy number variation

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Primer combination, kit and method for detecting autosomal copy number variation
  • Primer combination, kit and method for detecting autosomal copy number variation
  • Primer combination, kit and method for detecting autosomal copy number variation

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0058] Example 1 Establishment of detection of autochromatic copy number variation

[0059] 1. Design and synthesis of primer combinations

[0060] Design primer combinations according to the target retrotransposon region, including the following primer combinations:

[0061] Barcode primer (F1): Sequencing adapter 1 + barcode sequence for distinguishing different samples + universal sequence 1;

[0062] Upstream primer (F2): universal sequence 1 + molecular tag sequence + upstream specific primer sequence;

[0063] Optionally, the upstream primer (F2) is: general sequence 1+upstream specific primer sequence;

[0064] Downstream outer primer (R1): sequencing adapter 2+universal sequence 2;

[0065] Downstream inner primer (R2): universal sequence 2+downstream specific primer sequence;

[0066] Further, the length of the molecular tag is 6-30nt, consisting of M random bases and at least one set of specific bases, where M is a natural number greater than or equal to 6 and le...

Embodiment 2

[0121] Example 2 Detection of autochromatic copy number variation of genomic DNA in urinary sediment of bladder cancer

[0122] 1. Construction of amplicon library

[0123] 1) Design primers

[0124] The set of primers is:

[0125] Barcode primer (F1): sequencing adapter 1+barcode sequence+universal sequence 1;

[0126] Upstream primer (F2): universal sequence 1 + molecular tag + upstream specific primer sequence;

[0127] Downstream outer primer (R1): sequencing adapter 2+universal sequence 2;

[0128] Downstream inner primer (R2): universal sequence 2+downstream specific primer sequence;

[0129] The sequence of sequencing linker 1 is: CCATCTCATCCCTGCGTGTCTCCGACTCAG;

[0130] The sequence of general sequence 1 is: TCTGTACGGTGACAAGGCG;

[0131] The sequence of sequencing linker 2 is: CCTCTCTATGGGCAGTCGGTGAT;

[0132] The sequence of universal sequence 2 is: CTATGGGCAGTCGGTGAT;

[0133] The sequences of the upstream specific primer and the downstream specific primer ar...

Embodiment 3

[0175] Example 3 Autosomal copy number variation (CNV) of LINE-1 gene in brain cancer patients

[0176] Brain cancer training set construction: 30 healthy people as negative samples and 50 brain cancer patients with definite pathology as positive samples.

[0177] The samples to be tested were fresh surgical tumor tissue samples from 7 brain cancer patients.

[0178] 1. Amplicon library construction

[0179] 1. Synthesis of primers

[0180] Table 6 Primer Sequence

[0181]

[0182] Note: The barcode sequence corresponds to the 7 samples to be tested.

[0183] 2. According to the method in Example 1, the genomic DNA of the above-mentioned brain cancer training set and fresh surgical tumor tissue samples of 7 brain cancer patients was extracted, amplified and purified according to the method in Example 1 to finally obtain the training set and samples to be tested amplicon library.

[0184] 3. Compare and filter

[0185] Sequence the amplicon library of the training set ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a primer combination, a kit and a method for detecting autosomal copy number variation. The invention firstly provides the primer combination for detecting autosomal copy number variation. The primer combination comprises a Barcode primer, an upstream primer, a downstream outer primer and a downstream inner primer. The invention further discloses a method for detecting autosomal copy number variation. Retrotransposon regions are used as amplification specific target regions, the regions can be covered by designing one to several limited pairs of primers to enrich the whole genome, the copy number level of each region of different chromosomes can be truly reflected, a amplicon library is constructed by combining a one-step method, sample pollution is avoided, the method for detecting the autosomal copy number variation has the characteristics of simple operation, high sensitivity, high accuracy and low cost, and the application of the chromosome copy number detection method in actual detection can be truly realized.

Description

technical field [0001] The present invention relates to the field of biotechnology. Specifically relates to a primer combination, kit and method for detecting autosomal copy number variation. Background technique [0002] Studies have shown that the occurrence of tumors is related to the activation of proto-oncogenes and the inactivation of tumor suppressor genes, and chromosome copy number variation (CNV) also plays an important role in the occurrence and development of tumors. Chromosomal amplification or deletion may increase the copy number of some proto-oncogenes or decrease the copy number of tumor suppressor genes, affecting the expression of related genes. Chromosomal copy number variation exists in many tumors and is an important factor for cell carcinogenesis. index. [0003] There are many existing CNV detection technologies, such as fluorescence in situ hybridization technology, microarray technology, SNP typing chip, oligonucleotide microarray analysis technol...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityApplications(China)
IPC IPC(8): C12Q1/6851C12N15/11
CPCC12Q1/6851C12Q2531/113C12Q2535/122C12Q2537/16C12Q2537/165
Inventor郑乔松师晓谭达李乐李光宇焦宇辰王思振
OwnerGENETRON HEALTH (BEIJING) CO LTD