Primer combination, kit and method for detecting autosomal copy number variation
A copy number variation and primer combination technology, applied in biochemical equipment and methods, recombinant DNA technology, microbial assay/inspection, etc., can solve the problems of high probe specificity, high cost, and high detection cost, and eliminate the The effect of sample contamination, short testing period and low testing cost
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0058] Example 1 Establishment of detection of autochromatic copy number variation
[0059] 1. Design and synthesis of primer combinations
[0060] Design primer combinations according to the target retrotransposon region, including the following primer combinations:
[0061] Barcode primer (F1): Sequencing adapter 1 + barcode sequence for distinguishing different samples + universal sequence 1;
[0062] Upstream primer (F2): universal sequence 1 + molecular tag sequence + upstream specific primer sequence;
[0063] Optionally, the upstream primer (F2) is: general sequence 1+upstream specific primer sequence;
[0064] Downstream outer primer (R1): sequencing adapter 2+universal sequence 2;
[0065] Downstream inner primer (R2): universal sequence 2+downstream specific primer sequence;
[0066] Further, the length of the molecular tag is 6-30nt, consisting of M random bases and at least one set of specific bases, where M is a natural number greater than or equal to 6 and le...
Embodiment 2
[0121] Example 2 Detection of autochromatic copy number variation of genomic DNA in urinary sediment of bladder cancer
[0122] 1. Construction of amplicon library
[0123] 1) Design primers
[0124] The set of primers is:
[0125] Barcode primer (F1): sequencing adapter 1+barcode sequence+universal sequence 1;
[0126] Upstream primer (F2): universal sequence 1 + molecular tag + upstream specific primer sequence;
[0127] Downstream outer primer (R1): sequencing adapter 2+universal sequence 2;
[0128] Downstream inner primer (R2): universal sequence 2+downstream specific primer sequence;
[0129] The sequence of sequencing linker 1 is: CCATCTCATCCCTGCGTGTCTCCGACTCAG;
[0130] The sequence of general sequence 1 is: TCTGTACGGTGACAAGGCG;
[0131] The sequence of sequencing linker 2 is: CCTCTCTATGGGCAGTCGGTGAT;
[0132] The sequence of universal sequence 2 is: CTATGGGCAGTCGGTGAT;
[0133] The sequences of the upstream specific primer and the downstream specific primer ar...
Embodiment 3
[0175] Example 3 Autosomal copy number variation (CNV) of LINE-1 gene in brain cancer patients
[0176] Brain cancer training set construction: 30 healthy people as negative samples and 50 brain cancer patients with definite pathology as positive samples.
[0177] The samples to be tested were fresh surgical tumor tissue samples from 7 brain cancer patients.
[0178] 1. Amplicon library construction
[0179] 1. Synthesis of primers
[0180] Table 6 Primer Sequence
[0181]
[0182] Note: The barcode sequence corresponds to the 7 samples to be tested.
[0183] 2. According to the method in Example 1, the genomic DNA of the above-mentioned brain cancer training set and fresh surgical tumor tissue samples of 7 brain cancer patients was extracted, amplified and purified according to the method in Example 1 to finally obtain the training set and samples to be tested amplicon library.
[0184] 3. Compare and filter
[0185] Sequence the amplicon library of the training set ...
PUM
Abstract
Description
Claims
Application Information
- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com