Unlock instant, AI-driven research and patent intelligence for your innovation.

Bacillus licheniformis for enhancing ppc expression, and preparation method and application thereof

A technology of Bacillus licheniformis and a construction method, which is applied in the field of Bacillus licheniformis and preparation, and can solve problems such as failure to resolve the function of PpC

Active Publication Date: 2020-06-23
LIFECOME BIOCHEM
View PDF0 Cites 1 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0003] PpC is a phosphoenolpyruvate carboxylase, which plays a role in the central carbon metabolism of organisms. However, the current research has not resolved the specific function of PpC

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Bacillus licheniformis for enhancing ppc expression, and preparation method and application thereof
  • Bacillus licheniformis for enhancing ppc expression, and preparation method and application thereof
  • Bacillus licheniformis for enhancing ppc expression, and preparation method and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment approach

[0028] a reinforcement ppc The specific operation steps of the construction method of the bacillus licheniformis expressed are:

[0029] 1. The specific operation steps of step (1) are:

[0030] According to the genome DNA sequence of Corynebacterium glutamicum ATCC 13032 ppc gene sequence, design ppc The upstream primer (ppc-F) and downstream primer (ppc-R) of the gene; and using the genome DNA of Corynebacterium glutamicum ATCC 13032 as a template, respectively ppcThe upstream primers and downstream primers of the gene were amplified by PCR ppc Gene fragments (2760bp, such as figure 1 shown);

[0031] Among them, the sequences of ppc-F and ppc-R are:

[0032] ppc-F: TAAGAGAGGAATGTACACATGACTGATTTTTTACGCGATGA,

[0033] ppc-R: TCCGTCCTCTCTGCTCTTCTAGCCGGAGTTGCGCAGCGCA;

[0034] Then, the P43 promoter was amplified by PCR with the genomic DNA of Bacillus subtilis 168 (the primers used were P43-F and P43-R), and the amylase terminator was obtained by PCR amplification wit...

Embodiment 15

[0077] The difference between Example 15 and Example 14 is that in step (1), the Pppc promoter is obtained by PCR amplification of the Bacillus subtilis genomic DNA, and at the same time, the starch is obtained by PCR amplification using the Bacillus licheniformis DW2 genomic DNA as a template Enzyme terminator, followed by Pppc promoter, ppc The gene fragment and the amylase terminator were joined together by overlap extension PCR to obtain ppc The gene fragment with the Pppc promoter connected upstream and the amylase terminator connected downstream is the complete gene fragment. ppc expression element, the rest of the steps are the same as in Example 14, and finally the double exchange is successful ppc The integrated strain was named: Bacillus licheniformis DW2-ppc-1;

Embodiment 16

[0079] The difference between Example 16 and Example 14 is that in step (1), the P43 promoter is obtained by PCR amplification of Bacillus subtilis genomic DNA, and the Tppc terminator is obtained by PCR amplification of Bacillus subtilis genomic DNA, Then the P43 promoter, ppc The gene fragment and the Tppc terminator were joined together by overlap extension PCR to obtain ppc The gene fragment with the P43 promoter connected upstream and the Tppc terminator connected downstream is the complete gene fragment. ppc expression element, the rest of the steps are the same as in Example 14, and finally the double exchange is successful ppc The integrated strain was named: Bacillus licheniformis DW2-ppc-2.

[0080] The test data of bacitracin potency in the fermentation broth after the Bacillus licheniformis DW2-ppc-1 and Bacillus licheniformis DW2-ppc-2 constructed in Example 15 and Example 16 were respectively subjected to seed and production cultivation are shown in Table 3 bel...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention provides bacillus licheniformis for enhancing ppc expression, and a preparation method and application thereof. The bacillus licheniformis for enhancing ppc expression is bacillus licheniformis DW2-ppc prepared by inserting phosphoenolpyruvate carboxylase gene ppc derived from corynebacterium glutamicum ATCC 13032 into a genome of bacillus licheniformis DW2. Compared with the bacillus licheniformis DW2, the bacillus licheniformis DW2-ppc has the advantages that the bacitracin yield is improved by 12% or above.

Description

technical field [0001] The invention belongs to the technical field of genetic engineering bacteria transformation, in particular to a gene for strengthening phosphoenolpyruvate carboxylase ppc The expressed bacillus licheniformis and its preparation method and application. Background technique [0002] Bacitracin is a class of cyclic peptide antibiotics composed of 12 amino acid residues, and its constituent amino acids include ornithine (Orn), D-phenylalanine (D-Phe), isoleucine (His), D-Aspartic acid (D-Asp), Asparagine (Asn), Lysine (Lys), D-Glutamic acid (D-Glu), Cysteine ​​(Cys), Leucine (Leu ), isoleucine (Ile) and valine (Val) 11 kinds of amino acids. Bacitracin, also known as subtilisin, can inhibit or kill certain pathogenic bacteria, effectively inhibit the growth of Gram-positive bacteria such as Clostridium, and interact with other antibiotics (such as penicillin, gentamicin, etc.) It has a synergistic enhancement effect; in addition, bacitracin is hardly abs...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12N1/21C12N15/75C07K7/58C12P21/04C12R1/10
CPCC12N9/88C12Y401/01031C12N15/75C07K7/58C12P21/02
Inventor 陈守文蔡冬波吴非杨帆李俊辉陈晓斌季潇炜楼丽君邱湘琪
Owner LIFECOME BIOCHEM