Bacillus licheniformis for enhancing ppc expression, and preparation method and application thereof
A technology of Bacillus licheniformis and a construction method, which is applied in the field of Bacillus licheniformis and preparation, and can solve problems such as failure to resolve the function of PpC
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment approach
[0028] a reinforcement ppc The specific operation steps of the construction method of the bacillus licheniformis expressed are:
[0029] 1. The specific operation steps of step (1) are:
[0030] According to the genome DNA sequence of Corynebacterium glutamicum ATCC 13032 ppc gene sequence, design ppc The upstream primer (ppc-F) and downstream primer (ppc-R) of the gene; and using the genome DNA of Corynebacterium glutamicum ATCC 13032 as a template, respectively ppcThe upstream primers and downstream primers of the gene were amplified by PCR ppc Gene fragments (2760bp, such as figure 1 shown);
[0031] Among them, the sequences of ppc-F and ppc-R are:
[0032] ppc-F: TAAGAGAGGAATGTACACATGACTGATTTTTTACGCGATGA,
[0033] ppc-R: TCCGTCCTCTCTGCTCTTCTAGCCGGAGTTGCGCAGCGCA;
[0034] Then, the P43 promoter was amplified by PCR with the genomic DNA of Bacillus subtilis 168 (the primers used were P43-F and P43-R), and the amylase terminator was obtained by PCR amplification wit...
Embodiment 15
[0077] The difference between Example 15 and Example 14 is that in step (1), the Pppc promoter is obtained by PCR amplification of the Bacillus subtilis genomic DNA, and at the same time, the starch is obtained by PCR amplification using the Bacillus licheniformis DW2 genomic DNA as a template Enzyme terminator, followed by Pppc promoter, ppc The gene fragment and the amylase terminator were joined together by overlap extension PCR to obtain ppc The gene fragment with the Pppc promoter connected upstream and the amylase terminator connected downstream is the complete gene fragment. ppc expression element, the rest of the steps are the same as in Example 14, and finally the double exchange is successful ppc The integrated strain was named: Bacillus licheniformis DW2-ppc-1;
Embodiment 16
[0079] The difference between Example 16 and Example 14 is that in step (1), the P43 promoter is obtained by PCR amplification of Bacillus subtilis genomic DNA, and the Tppc terminator is obtained by PCR amplification of Bacillus subtilis genomic DNA, Then the P43 promoter, ppc The gene fragment and the Tppc terminator were joined together by overlap extension PCR to obtain ppc The gene fragment with the P43 promoter connected upstream and the Tppc terminator connected downstream is the complete gene fragment. ppc expression element, the rest of the steps are the same as in Example 14, and finally the double exchange is successful ppc The integrated strain was named: Bacillus licheniformis DW2-ppc-2.
[0080] The test data of bacitracin potency in the fermentation broth after the Bacillus licheniformis DW2-ppc-1 and Bacillus licheniformis DW2-ppc-2 constructed in Example 15 and Example 16 were respectively subjected to seed and production cultivation are shown in Table 3 bel...
PUM
Abstract
Description
Claims
Application Information
- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap