Construction method and application of rolling-circle replication recombinant vector for heterologous protein expression
A construction method and a technology of rolling circle replication, applied in the fields of biotechnology and botany, can solve the problems of hypersensitivity injection area, short duration, and long transformation procedure (often needing 6-10 months, etc.) Stability, improved ease of use, efficient Agrobacterium infection and gene expression effects
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0049] Embodiment 1, obtain SPLCV-XZ virus gene
[0050] The typical plants with sweet potato leafroll virus phenotype in Xuzhou area were obtained, the DNA was extracted by CTAB method after freezing and grinding in liquid nitrogen, and the corresponding PCR products were obtained by using the conserved primers of the virus for PCR primer amplification.
[0051] The conserved primer sequence is RAC 1F: gcactgggattccacaagatcttcc (SEQ ID NO: 1)
[0052] RAC 1R: attggggtggaactgggtgga (SEQ ID NO: 2)
[0053] The PCR amplification reaction conditions are: denaturation at 98°C for 30 seconds, annealing at 62°C for 30 seconds, and extension at 72°C for 2 minutes, a total of 32 cycles. )
[0054] The PCR product was ligated and circularized using a T-vector ligation kit (purchased from Beijing Quanshijin Biotechnology Co., Ltd.) to obtain a cloned plasmid, and the obtained cloned plasmid was sent to a sequencing company for sequencing to obtain the Xuzhou strain of sweet potato lea...
Embodiment 2
[0055] Example 2 Construction of pCambia0390-SPLCV / NbU4-EGFP recombinant vector with the construction method of the present invention
[0056] The specific method for the construction of the high-efficiency expression recombinant vector of the present invention is as follows:
[0057] Step 1), design primers for the gene information obtained by sequencing to carry out follow-up work, respectively design 2 pairs of cloning primers with adapters to amplify the SPLCV-XZ sequence, wherein the first segment of the amplified sequence only includes SPLCV-IL (SEQ ID NO : 4) (284bp) region, the second amplified sequence contains SPLCV-IL-(AC1-AC4)-UTR (1900bp) (SEQ ID NO: 5), wherein T-SPLCV-XZ-nIR is SPLCV-IL- (AC1-AC4)-UTR (1900bp) tail sequence, its specific sequence is: T-SPLCV-XZ-nIR (SEQ ID NO: 6): taaaatttgttttta (its structure is an analog of Poly A, which acts as a terminator role, its RNA secondary structure such as figure 2 ), participate in the transcriptional terminatio...
Embodiment 3
[0065] Embodiment 3 High-efficiency expression test of the recombinant vector of the present invention in Nicotiana benthamiana
[0066] Transform pCambia0390-SPLCV / NbU4-EGFP into Agrobacterium GV3101 by chemical transformation to obtain a positive bacterial liquid, inject it into the left side of Nicotiana benthamiana with a 1ml sterile syringe, and name it pRI201-EGFP. In order to verify the experimental effect, Agrobacterium GV3101 transformed with T-DNA vector was injected on the right side of Nicotiana benthamiana, named T-DNA pRI201-EGFP. After 3-15 days of injection, compare the expression efficiency of EGFP on both sides according to the intensity of fluorescence.
[0067] To detect whether rolling circle replication occurs in the injected region, design rolling circle replication detection primers:
[0068] Check RAC 1F: gcactgggattccacaagatcttcc (SEQ ID NO: 13)
[0069] Check RAC 1R: attggggtggaactgggtgga (SEQ ID NO: 14)
[0070] Samples were extracted according t...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More - R&D
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com



