Construction method and application of rolling-circle replication recombinant vector for heterologous protein expression

A construction method and a technology of rolling circle replication, applied in the fields of biotechnology and botany, can solve the problems of hypersensitivity injection area, short duration, and long transformation procedure (often needing 6-10 months, etc.) Stability, improved ease of use, efficient Agrobacterium infection and gene expression effects

Active Publication Date: 2020-06-23
XUZHOU NORMAL UNIVERSITY
View PDF2 Cites 5 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

The best way to express heterologous proteins is to obtain transgenic plants capable of sustained and stable expression of exogenous genes through molecular cloning; however, due to factors such as complex vector construction and long transformation procedures (often 6-10 months) impact, which directly limits the use of the method
[0003] The construction of a transient expression vector with a T-DNA insertion region is an alternative for the study of plant heterologous protein expression. By transforming the constructed vector into Agrobacterium and directly infecting the plant with a syringe, the injection area can be kept within a period of time. Stable and continuous expression of the target protein, this method is simple to operate and highly time-sensitive, and the entire process may only take about 10 days to complete; however, this method also has some inherent defects, which directly limit the use of this method: (1) continuous The time is short, and the longest expression time of the protein can only be maintained for about 5-7 days; (2). The ability to express proteins with larger molecular weights is poor; (3) Excessive injection of bacteria can easily lead to hypersensitivity reactions and cause bruises in the injection area. Withered necrosis

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Construction method and application of rolling-circle replication recombinant vector for heterologous protein expression
  • Construction method and application of rolling-circle replication recombinant vector for heterologous protein expression
  • Construction method and application of rolling-circle replication recombinant vector for heterologous protein expression

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0049] Embodiment 1, obtain SPLCV-XZ virus gene

[0050] The typical plants with sweet potato leafroll virus phenotype in Xuzhou area were obtained, the DNA was extracted by CTAB method after freezing and grinding in liquid nitrogen, and the corresponding PCR products were obtained by using the conserved primers of the virus for PCR primer amplification.

[0051] The conserved primer sequence is RAC 1F: gcactgggattccacaagatcttcc (SEQ ID NO: 1)

[0052] RAC 1R: attggggtggaactgggtgga (SEQ ID NO: 2)

[0053] The PCR amplification reaction conditions are: denaturation at 98°C for 30 seconds, annealing at 62°C for 30 seconds, and extension at 72°C for 2 minutes, a total of 32 cycles. )

[0054] The PCR product was ligated and circularized using a T-vector ligation kit (purchased from Beijing Quanshijin Biotechnology Co., Ltd.) to obtain a cloned plasmid, and the obtained cloned plasmid was sent to a sequencing company for sequencing to obtain the Xuzhou strain of sweet potato lea...

Embodiment 2

[0055] Example 2 Construction of pCambia0390-SPLCV / NbU4-EGFP recombinant vector with the construction method of the present invention

[0056] The specific method for the construction of the high-efficiency expression recombinant vector of the present invention is as follows:

[0057] Step 1), design primers for the gene information obtained by sequencing to carry out follow-up work, respectively design 2 pairs of cloning primers with adapters to amplify the SPLCV-XZ sequence, wherein the first segment of the amplified sequence only includes SPLCV-IL (SEQ ID NO : 4) (284bp) region, the second amplified sequence contains SPLCV-IL-(AC1-AC4)-UTR (1900bp) (SEQ ID NO: 5), wherein T-SPLCV-XZ-nIR is SPLCV-IL- (AC1-AC4)-UTR (1900bp) tail sequence, its specific sequence is: T-SPLCV-XZ-nIR (SEQ ID NO: 6): taaaatttgttttta (its structure is an analog of Poly A, which acts as a terminator role, its RNA secondary structure such as figure 2 ), participate in the transcriptional terminatio...

Embodiment 3

[0065] Embodiment 3 High-efficiency expression test of the recombinant vector of the present invention in Nicotiana benthamiana

[0066] Transform pCambia0390-SPLCV / NbU4-EGFP into Agrobacterium GV3101 by chemical transformation to obtain a positive bacterial liquid, inject it into the left side of Nicotiana benthamiana with a 1ml sterile syringe, and name it pRI201-EGFP. In order to verify the experimental effect, Agrobacterium GV3101 transformed with T-DNA vector was injected on the right side of Nicotiana benthamiana, named T-DNA pRI201-EGFP. After 3-15 days of injection, compare the expression efficiency of EGFP on both sides according to the intensity of fluorescence.

[0067] To detect whether rolling circle replication occurs in the injected region, design rolling circle replication detection primers:

[0068] Check RAC 1F: gcactgggattccacaagatcttcc (SEQ ID NO: 13)

[0069] Check RAC 1R: attggggtggaactgggtgga (SEQ ID NO: 14)

[0070] Samples were extracted according t...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

PUM

No PUM Login to view more

Abstract

The invention belongs to the field of biotechnology and botany, and particularly provides a construction method of a rolling-circle replication recombinant vector for heterologous protein expression,the recombinant vector and an application of the recombinant vector. According to the construction method provided by the invention, the high-efficiency rolling-circle replication transient expressionvector mainly based on the sequence of a sweet potato leaf curl virus (SPLCV) is constructed, so that duration time and expression abundance of heterologous nucleic acids and proteins on plants are remarkably improved, and the results of the vector have high repeatability and reliability. The recombinant vector provided by the invention has a molecular tool vector which has an extremely long expression time to heterologous proteins (longer than 20 day compared with the expression time of a common transient expression T vector) and has an extremely high expression abundance (larger than 30-fold expression compared with a common transient expression T vector), and the recombinant vector endows different plants (tobaccos, sweet potatoes and morning glory) with heterologous protein expressioncapability, and makes up the blank of related plants for utilizing transient expression to study gene functions.

Description

technical field [0001] The invention belongs to the fields of biotechnology and botany, and more specifically relates to the development of a construction method, recombinant vector and application of a rolling circle replication recombinant vector for efficient and transient expression of heterologous proteins in different plants. Background technique [0002] Using plants to express heterologous proteins is a general research technique for studying plants. For example, in the study of plant functional genes, model plants (Arabidopsis, Nicotiana benthamiana) are used to express unknown genes of non-model plants to verify their gene functions; Plant reactors (spinach, tobacco) express certain medicinal proteins and separate and purify the target proteins. The best way to express heterologous proteins is to obtain transgenic plants capable of sustained and stable expression of exogenous genes through molecular cloning; however, due to factors such as complex vector constructi...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

Application Information

Patent Timeline
no application Login to view more
Patent Type & Authority Applications(China)
IPC IPC(8): C12N15/84C12N15/66
CPCC12N15/8216C12N15/8205C12N15/8206C12N15/8207
Inventor 余益成孙健李宗芸
Owner XUZHOU NORMAL UNIVERSITY
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Try Eureka
PatSnap group products