Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Lentivirus-infected human epidermal keratinocyte strain as well as construction method and application thereof

A construction method and host cell technology are applied in the field of lentivirus-infected human epidermal keratinocyte strain and its construction, which can solve the problems of lack of in-depth research on in vitro cell models, and achieve the effects of remarkable effect, strong genetic stability and reduced expression.

Inactive Publication Date: 2020-08-18
南京市江宁医院
View PDF11 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Based on the important role of PP2A in the regulation of cell fate, combined with the current research on PP2A in the skin, only a small amount exists in clinical reports and animal models, and there is a lack of in-depth research on in vitro cell models

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Lentivirus-infected human epidermal keratinocyte strain as well as construction method and application thereof
  • Lentivirus-infected human epidermal keratinocyte strain as well as construction method and application thereof
  • Lentivirus-infected human epidermal keratinocyte strain as well as construction method and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0056] Example 1 Construction of PPP2CA-shRNA lentiviral vector

[0057] 1. Design of shRNA sequence

[0058] For the target gene sequence of the PPP2CA target gene, use BLOCK-iT TM The RNAi Designer website is used to design RNA interference sequences. The design results are https: / / rnaidesigner.thermofisher.com / rnaiexpress / design.do. We selected the accession number as CR457417.1, the ORF region as 1-930, and the start sites as 483 ( The sequences of shRNA1) and 217 (shRNA2) were used as shRNA oligos. The NC fragment in the control group is a nonsense general sequence and does not target the target gene.

[0059] The designed shRNA1-2 sequences and the control NC sequence are as follows:

[0060] No. TargetSeq NC TTCTCCGAACGTGTCACGT shRNA1 GCAGATCTTCTGTCTACATGG shRNA2 GGCAAATCACCAGATACAAAT

[0061] 2. Design of shRNA primers

[0062] According to the above gene sequences, the upstream and downstream primer sequences of shRNA oligomer...

Embodiment 2

[0121] Example 2 Infection of Hacat cells with PPP2CA-shRNA lentivirus and screening

[0122] 1. Human epidermal keratin hacat cells growing in the logarithmic phase were mixed with 1×10 5 Cells / ml were inoculated in 48-well plates, cultured in DMEM medium with 10% fetal bovine serum, 37°C, 5% CO 2 Cultivate overnight in an incubator for 24 hours, and the degree of cell confluence at the time of infection is about 40%;

[0123] 2. Dilute the virus and infect the cells with the lentivirus PPP2CA-sh1(SC5), PPP2CA-sh2(SC5) and the control lentivirus PPP2CA-NC(SC5) at an MOI value of 20, infect the cells, take out the plated cells, and discard them Old culture medium, add 200mL / well of diluted virus solution, culture and culture in DMEM with 10% fetal bovine serum, 37°C, 5% CO 2 The incubator was cultivated for 8 hours and replaced with DMEM medium containing 10% serum and 1% double antibodies (penicillin and streptomycin);

[0124] 3. After 48 hours of infection, observe the b...

Embodiment 3

[0127] Example 3 Using qRT-PCR to detect the expression of PPP2CA at the mRNA level of infected cells

[0128] 1. RNA concentration and purity determination: the RNA samples of the lentivirus PPP2CA-sh1 (SC5), PPP2CA-sh2 (SC5) and the control group lentivirus PPP2CA-NC (SC5) cultivated in Example 2 were diluted 50 times with DEPC water Finally, the OD value and RNA concentration were detected, and the OD value was controlled between 1.8-2.0.

[0129] 2. Reverse transcription PCR reaction (Japan TAKARA reverse transcription kit): reverse transcription reaction (20μl system):

[0130] ①Take an imported RNase-free PCR tube, add RNA (1 μg), Oligo dT 1 μL, and RNA-free water to make up to 10 μl in sequence;

[0131] ② Place in a PCR instrument at 70°C for 5 minutes, then take it out immediately and place it on ice for at least 1 minute;

[0132] ③ Add: RNase inhibitor 1 μL, 5×RT buffer 5 μL, dNTPs 5 μL, reverse transcriptase 1 μL;

[0133] ④ Place the reaction PCR tube in the PC...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a shRNA fragment. The invention also discloses a recombinant plasmid containing the shRNA. The invention also discloses a recombinant strain. The invention also discloses a construction method of a recombinant plasmid and a construction method of the recombinant strain. The cell strain disclosed by the invention is high in hereditary stability, and a transferred gene is still kept from being lost after 30 times or more of passage; the knockdown effect on PPP2CA is remarkable, and the expression of PPP2CA in mRNA and protein levels can be effectively reduced; the cell strain disclosed by the invention has good experimental phenotype, and the multiplication capacity of a positive cell strain is obviously higher than that of a control group cell strain.

Description

technical field [0001] The invention belongs to the research fields of molecular biology, genetic engineering and skin basic science, and specifically relates to a lentivirus-infected human epidermal keratinocyte strain and a construction method and application thereof. Background technique [0002] Keratinocytes are the main cells that make up the epidermis, accounting for more than 80% of epidermal cells. Studies have found that hyperproliferation of epidermal keratinocytes occurs in many malignant skin diseases including psoriasis. Such as: arsenic poisoning and its precancerous skin hyperproliferation of epidermal cells and abnormal keratinization of the skin. The clinical features of psoriasis are also characterized by hyperplasia of epidermal keratinocytes, and the abnormal proliferation of epidermal keratinocytes is associated with the generation of massive scales. The current drug treatments for psoriasis mainly include regulating the abnormal proliferation and dif...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N15/113C12N15/867C12N15/66C12N5/10
CPCC12N5/0629C12N15/1137C12N15/66C12N15/86C12N2310/14C12N2310/531C12N2503/02C12N2510/00C12N2740/15043C12Y301/03016
Inventor 方超陈建泉张敏
Owner 南京市江宁医院
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com