Swine fever virus recombinant antigen as well as preparation method and application thereof

A recombinant antigen, swine fever virus technology, applied in the direction of virus antigen components, botanical equipment and methods, biochemical equipment and methods, etc., can solve the problem of insufficiency, low immunogenicity, and failure to effectively control the occurrence and spread of swine fever and other problems, to achieve the effect of low production cost, high cell expression, and improved immunogenicity

Active Publication Date: 2020-09-29
苏州世诺生物技术有限公司
View PDF4 Cites 1 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Since the 1950s, the attenuated CSF vaccine ("C" strain) developed by my country has been widely used. However, the long-term use of the CSF vaccine has not effectively controlled the occurrence and spread of CSF. It has low sensitivity and cannot meet the needs of modern prevention and control and eradication of swine fever.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Swine fever virus recombinant antigen as well as preparation method and application thereof
  • Swine fever virus recombinant antigen as well as preparation method and application thereof
  • Swine fever virus recombinant antigen as well as preparation method and application thereof

Examples

Experimental program
Comparison scheme
Effect test

preparation example Construction

[0047] A method for preparing a recombinant antigen of classical swine fever virus according to an embodiment of the present invention comprises the following steps: cultivating the above-mentioned host cells under suitable conditions, collecting the culture medium and / or lysate of the host cells, and then separating and purifying to obtain classical swine fever virus Viral Recombinant Antigen.

[0048] In a specific example, separation and purification methods include nickel column affinity chromatography, molecular sieve chromatography, etc., are not limited thereto, and can be selected according to needs.

[0049] The classical swine fever vaccine of one embodiment of the present invention comprises the above-mentioned recombinant antigen of classical swine fever virus and a pharmaceutically acceptable adjuvant.

[0050] In a specific example, the adjuvant can be one or a combination of two or more of white oil, aluminum stearate, sipene, and Tween, and white oil adjuvant i...

Embodiment 1

[0053] (1), construction of recombinant eukaryotic expression vector pCI-NE2-GS

[0054] 1. NE2 gene amplification and purification

[0055] The codon-optimized NE2 gene (SEQ ID NO: 1) was synthesized in Shanghai Sunny Biotechnology Co., Ltd. and cloned into the pUC-57 vector to obtain the pUC-NE2 plasmid vector. Using pUC-NE2 as a template and NE2-F and NE2-R as primers for PCR amplification, the amplification system is shown in Table 1. The reaction conditions were: pre-denaturation at 94°C for 5 minutes; denaturation at 95°C for 45 seconds, renaturation at 60°C for 45 seconds, extension at 72°C for 2 minutes, 30 cycles; extension at 72°C for 10 minutes, and storage at 4°C.

[0056] NE2-F: ATACTCGAGGCCGCCACCATGGAAACAGATACACTCCTCCTCTGGG

[0057] NE2-R: ATAGGTACCTCATCAATGGTGATGATGGTGGTGGGCGGGGCTCAGAA

[0058] Table 1 NE2 gene amplification system

[0059]

[0060]

[0061] Perform gel electrophoresis on the PCR product to identify the size of the target gene, such as...

Embodiment 2

[0120] Example 2 SDS-PAGE detection

[0121] The cell culture supernatants of the NE2 group, E2-1 group, E2-2 group, E2-3 group and E2-4 group harvested in Example 1 were detected by SDS-PAGE, and the NE2 group, E2-1 group and E2-2 groups using the endoglycosidase EndoH f SDS-PAGE was performed after treatment, and empty CHO cells were used as a negative control. The specific operation is as follows: take 40 μL of the harvested cell culture, add 10 μL of 5× sample buffer, bathe in boiling water for 5 minutes, centrifuge at 12000 r / min for 1 minute, and take the supernatant for SDS-PAGE gel (12% concentration gel) Electrophoresis. After electrophoresis, the gel was stained and decolorized to observe the target band.

[0122] Test results such as Figure 4 As shown, the NE2 group, E2-1 group, E2-2 group, E2-3 group and E2-4 group appeared target bands around the molecular weight of about 60kDa, 62kDa, 58kDa, 57kDa and 53kDa, using the endoglycosidase EndoH f After treatment,...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

PropertyMeasurementUnit
diameteraaaaaaaaaa
Login to View More

Abstract

The invention relates to a swine fever virus recombinant antigen as well as a preparation method and application thereof. The swine fever virus recombinant antigen is E2 protein modified by protein, wherein the protein modification comprises point mutation, and the point mutation is used for mutating 166th amino acid of the E2 protein into asparagine and mutating 229th amino acid into alanine. According to the swine fever virus recombinant antigen, the 229th Asn amino acid of a key glycosylation locus of the E2 protein is mutated into Ala, so that glycosylation can be removed; and furthermore,the 166th Asp amino acid is mutated into Asn, a new glycosylation locus is introduced, so that the immunogenicity of the protein can be increased, and the anaphylactic reaction of the protein can bereduced.

Description

technical field [0001] The invention relates to the field of molecular biology technology, in particular to a recombinant antigen of swine fever virus and its preparation method and application. Background technique [0002] Classical swine fever (CSF) is an acute, febrile and highly contagious infectious disease caused by classical swine fever virus (CSFV), with high fever and bleeding as the main symptoms, and its pathological cause is mainly small Degeneration of blood vessel walls, leading to internal organ bleeding, infarction or even necrosis. The main routes of transmission are contact transmission, gastrointestinal transmission or respiratory transmission. The disease can cause acute, subacute, chronic or even delayed infection, and can also cause subclinical symptoms without disease. Because pigs of different ages, sexes and breeds can be infected, swine fever has caused huge economic losses to the pig industry. The disease is distributed in many countries and re...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityApplications(China)
IPC IPC(8): C07K14/18C12N15/40C12N15/85C12N5/10A61K39/187A61P31/14
CPCA61K39/12A61K2039/552A61P31/14C07K14/005C12N15/85C12N2770/24322C12N2770/24334
Inventor曹文龙孔迪滕小锘易小萍张大鹤
Owner苏州世诺生物技术有限公司