Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Anti-canine matrix metalloproteinase hybridoma cell strain, preparation method of hybridoma cell strain, monoclonal antibody and application of monoclonal antibody

A technology of hybridoma cell lines and monoclonal antibodies, which is applied in the field of monoclonal antibodies, biotechnology-monoclonal antibodies, can solve the problems of no reports on the application of monoclonal antibodies to hybridoma cell lines, etc., and achieve good uniformity, High purity and strong specific effect

Active Publication Date: 2020-10-02
HUAZHONG AGRI UNIV
View PDF8 Cites 3 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

At present, the preparation of anti-canine MMP-13 monoclonal antibody hybridoma cell line and the application of monoclonal antibody have not been reported yet.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Anti-canine matrix metalloproteinase hybridoma cell strain, preparation method of hybridoma cell strain, monoclonal antibody and application of monoclonal antibody
  • Anti-canine matrix metalloproteinase hybridoma cell strain, preparation method of hybridoma cell strain, monoclonal antibody and application of monoclonal antibody
  • Anti-canine matrix metalloproteinase hybridoma cell strain, preparation method of hybridoma cell strain, monoclonal antibody and application of monoclonal antibody

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0064] Obtaining of canine recombinant matrix metalloproteinase (MMP-13).

[0065] The matrix metalloproteinase provided by the present invention as an antigen is RNA extracted from German shepherd dog knee articular cartilage tissue using genetic engineering technology, and the matrix metalloproteinase gene is obtained through reverse transcription and RT-PCR, then cloned into a plasmid, transformed After expression in Escherichia coli, the specific cloning and purification process is as follows:

[0066] 1) First, the matrix metalloproteinase gene was cloned and sequenced from German Shepherd dog knee articular cartilage tissue using conventional techniques. The specific conditions for reverse transcription and RT-PCR and the corresponding primer sequences are:

[0067] Upstream primers: GGAATTC ATGAGTCACCACTGCAGGTC is underlined as the Eco R1 site

[0068] Downstream primer: G CCTCGAG TTAACACCACAACAGGGAGT, underlined as Xho 1 site

[0069] Template cDNA synthesis after...

Embodiment 2

[0076] Production of canine MMP-13 monoclonal antibody hybridoma cell line and preparation of canine MMP-13 monoclonal antibody

[0077] 1) Antigen for immunization: MMP-13 of dogs obtained in step 2) of Example 1;

[0078] 2) Immunization procedure: BALB / c mice (purchased from the Animal Experiment Center of Huazhong Agricultural University) were used as immunized animals. The dose of antigen for the first immunization was 100 μg / mouse, injected subcutaneously at multiple points, and boosted immunized 4 times at intervals of 10-14 days , take splenocytes;

[0079] 3) Cell fusion: Myeloma cells SP 2 / 0 in the logarithmic growth phase and splenocytes were used for cell fusion in a solvent of polyethylene glycol (molecular weight 4000), in a medium containing HAT (H is the abbreviation of Hypoxanthine, A is the abbreviation of methotrexate Aminopterin, and T is the abbreviation of thymidine Thymidine) culture medium for selective cultivation;

[0080] 4) Hybridoma cell cloning:...

Embodiment 3

[0086] Indirect ELISA method was used to determine the optimum coating concentration of antigen.

[0087] 1) The antigen was diluted with coating buffer CBS (0.05mol carbonate buffer, pH 9.6) at a concentration of 1 μg / mL for a 1:2 ratio. Coat a row at every dilution and add enzyme at 100 μL / well In the target plate, the film was sealed (to prevent moisture evaporation) and coated overnight at 4°C.

[0088] 2) Shake off the liquid in the plate the next day, pat the plate dry on absorbent paper, add 150 μL of blocking solution (coating buffer CBS containing 1% BSA) to each well, and keep at room temperature for more than 2 hours.

[0089] Use the washing solution PBST (PBS containing 0.05% Tween-20, pH 7.4) to make serial 1:2 dilutions starting from 1:500, add 100 μL / well, and incubate at 37°C for 1 hour.

[0090] 3) Take it out and pat dry, wash the plate 3 times with washing solution, add 100 μL of secondary antibody working solution (dilute HRP-labeled goat anti-mouse IgG w...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to an anti-canine matrix metalloproteinase 13 (MMP-13) hybridoma cell strain, a preparation method of the hybridoma cell strain, a monoclonal antibody and application of the monoclonal antibody. The preservation number of the hybridoma cell strain is CCTCC NO: C2019290, and the hybridoma cell strain is classified and named as an anti-canine MMP-13 hybridoma cell strain 8C7. The anti-canine MMP-13 hybridoma cell strain is obtained by the following method: (1) performing expressing of an immunogen by adopting a PET-28a (+) expression vector under the induction of IPTG, andperforming immunizing on a BALB / c mouse with the immunogen; (2) performing fusing on immunized mouse splenocytes with SP2 / 0 myeloma cells; and (3) performing screening to obtain the hybridoma cell secreting the anti-canine MMP-13 monoclonal antibody. The high-purity canine MMP-13 antigen is obtained through purification by adopting a Ni-NTA-sefinose chromatographic column, so that screening of subsequent positive clones and generation of antibody are ensured, and generation and titer of the monoclonal antibody are determined to be rapidly measured by an indirect ELISA method; a large number ofmonoclonal antibodies are obtained by inoculating the abdominal cavity of a BALB / c female mouse, and the antibody has the advantages of strong specificity, high purity, high uniformity and the like,and has a good application effect in western blot and immunofluorescence methods for detecting MMP-13.

Description

technical field [0001] The invention belongs to the field of biotechnology-monoclonal antibodies, and in particular relates to a hybridoma cell strain resistant to canine matrix metalloproteinase, a preparation method thereof, a monoclonal antibody and applications thereof. Background technique [0002] Matrix metalloproteinases (matrix metalloproteinases, MMPs) are calcium ion-dependent proteases containing zinc, which can degrade most of the components contained in the extracellular matrix (extracellular matrix, ECM). So far, more than 20 kinds of matrix metalloproteinases have been found, which can be divided into collagenases (collagenases), gelatinases (gelatinases), stromelysins (stromelysins), membrane-type matrix metalloproteinases ( membrane-type MMP, MT-MMP) and other types of matrix metalloproteinases. The matrix metalloproteinase family includes five common domains: signal peptide and propeptide, catalytic domain, and hemopexin-like C-terminal domain, the latter...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12N5/20C07K16/40C12N15/70G01N33/577G01N33/573C12R1/91
CPCC07K16/40C12N15/70G01N33/577G01N33/573G01N2333/96494
Inventor 丁一丁明星王卓乐朱红梅杨迪琦庄深李桥孙晋睿
Owner HUAZHONG AGRI UNIV
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com