Primer, method and reagent kit for detecting HBB gene mutation

A technology of kits and sequencing primers, which is applied in the fields of life science and biology, can solve the problems of tedious, time-consuming and labor-intensive detection of gene HBB, and achieve the effects of simplifying operation steps, saving detection costs, and reducing detection costs

Pending Publication Date: 2020-10-02
南京艾迪康医学检验所有限公司
View PDF3 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

This high degree of homology makes it difficult to detect HBB mutations. Therefore, qPCR technology cannot be applied to the detection of complex rearrangements, and it is difficult to carry out extensive research.
Other techniques such as Southern hybridization, allele-specific polymerase chain reaction, allele-specific oligonucleotide probes, RFLP, etc. are cumbersome, time-consuming, or unable to detect all mutation types, etc., and cannot be used These methods detect mutations in the gene HBB

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Primer, method and reagent kit for detecting HBB gene mutation
  • Primer, method and reagent kit for detecting HBB gene mutation
  • Primer, method and reagent kit for detecting HBB gene mutation

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0056] Kits for detecting gene HBB mutation sites, including: tissue DNA extraction kit (for example, using Tiangen Bio’s DNA extraction kit); absolute ethanol; amplification system PCR reaction solution, sequencing system reaction solution, positive control , negative control substance and blank control substance, wherein

[0057] Amplification system PCR reaction solution includes: 2×PCR Buffer; 2mMdNTPs; KOD FX DNA Polymerase (1U / μl); at least one pair of amplification primers are used to amplify the gene HBB, and the amplification primers are selected from HBB-1_2F / HBB-1_2R , HBB-3_6F / HBB-3_6R, HBB-7_9F / HBB-7_9R, HBB-10F / HBB-10R, the base sequence of which is:

[0058] HBB-1_2F: TGATGTGGAACCAGAAAGCTGTAAAACGACGGCCAGT

[0059] HBB-1_2R: GGGCAGCATAGCAAGAACAACAGCTATGACCATG;

[0060] HBB-3_6F: TCCCACCTCAGCCTCAAGTTGTAAAACGACGGCCAGT

[0061] HBB-3_6R: ACCCGCCTCATAGCAATGAACAGCTATGACCATG;

[0062] HBB-7_9F: ACAGCCAGTGATGCTACCGTGTAAAACGACGGCCAGT

[0063] HBB-7_9R:ACCAGCCTCCACCA...

Embodiment 2

[0075] Example 2 Blood sample DNA detection process

[0076] (1) Genomic DNA extraction from blood:

[0077] 1) Draw 500uL of blood and add 1000uL of red blood cell lysate, mix it upside down, place it at room temperature for 5 minutes, and then mix it upside down several times during this period, then centrifuge at 3000rpm for 5min, absorb the supernatant, leave the white blood cell precipitate, add 200uL buffer GA, shake until thoroughly mixed;

[0078] 2) Add 20 μl proteinase K solution and mix well;

[0079] 3) Add 200 μl buffer GB, mix thoroughly by inversion, place at 70°C for 10 minutes, the solution should become clear, and briefly centrifuge to remove water droplets on the inner wall of the tube cap;

[0080] 4) Add 200 μl of absolute ethanol, shake and mix well for 15 seconds. At this time, flocculent sediment may appear, and briefly centrifuge to remove water droplets on the inner wall of the tube cap;

[0081] 5) Add the solution and flocculent precipitate obtai...

Embodiment 3

[0114] Three clinical whole blood samples were taken, and the whole exon mutation of the HBB gene related to β-thalassemia was detected in each sample. The genome was extracted, reagents were prepared and tested according to the method described in Example 2. For each sample, 2 μl of the extracted genomic DNA was added to the PCR reaction solution of the amplification system, and positive, negative, and blank control experiments were performed at the same time. A 96-well ordinary PCR machine can detect 46 samples at the same time, each sample has 2 repetitions, a positive control, a negative control and a blank control. The detection time is 160 minutes.

[0115] In addition, the sequencing results of sample 1 are as follows Figure 1-4 All shown are wild type. The sequencing results of samples 2 and 3 were also wild type.

[0116] It can be seen from the detection results that the primers of the present invention have included all the exons of the HBB gene to be detected,...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a method, primer and reagent kit for detecting HBB gene mutation pertinent to beta thalassaemia. The primer and reagent kit both comprise an amplifying primer for HBB gene whole exons and a sequencing primer. Based on PCR amplification and Sanger sequencing, the mutation situation of an HBB gene mutation site pertinent to the beta thalassaemia can be quickly detected.

Description

technical field [0001] The invention belongs to the field of life science and biotechnology, and particularly relates to a method, a primer and a kit for detecting HBB gene mutation related to beta thalassemia. Background technique [0002] Beta thalassemia (CAH) is a group of autosomal recessive genetic diseases caused by defects in the enzymes involved in the synthesis of adrenocortical hormones. According to enzyme deficiency, Chengdu CAH can be divided into salt-losing CAH, simple virilizing CAH, and atypical CAH. The former two are collectively referred to as typical CAH. The incidence of the disease is low, the incidence of neonatal CAH is about 1 / 16000~1 / 20000, the incidence of typical CAH is about 1 / 10000, the incidence of atypical CAH is about 10 times of the typical, and female more than men. 21 hydroxylase deficiency (21OHD) is the most common type, accounting for about 90%-95%, and the incidence of 21OHD in newborns is about 1 / 15000-1 / 18000. [0003] The gene ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12Q1/6883C12Q1/6869C12N15/11
CPCC12Q1/6883C12Q1/6869C12Q2600/156C12Q2525/191C12Q2535/101C12Q2531/113C12Q2527/143C12Q2527/101
Inventor柏忠良
Owner南京艾迪康医学检验所有限公司